Advertisement

Evaluation of human adipose-derived mesenchymal stromal cell Toll-like receptor priming and effects on interaction with prostate cancer cells

Open AccessPublished:October 16, 2022DOI:https://doi.org/10.1016/j.jcyt.2022.09.009

      Abstract

      Background aims

      Mesenchymal stromal cells (MSCs) are a multipotent cell population of clinical interest because of their ability to migrate to injury and tumor sites, where they may participate in tissue repair and modulation of immune response. Although the processes regulating MSC function are incompletely understood, it has been shown that stimulation of Toll-like receptors (TLRs) can alter MSC activity. More specifically, it has been reported that human bone marrow-derived MSCs can be “polarized” by TLR priming into contrasting immunomodulatory functions, with opposite (supportive or suppressive) roles in tumor progression and inflammation. Adipose-derived MSCs (ASCs) represent a promising alternative MSC subpopulation for therapeutic development because of their relative ease of isolation and higher abundance compared with their bone marrow-derived counterparts; however, the polarization of ASCs remains unreported.

      Methods

      In this study, we evaluated the phenotypic and functional consequences of short-term, low-level stimulation of ASCs with TLR3 and TLR4 agonists.

      Results

      In these assays, we identified transient gene expression changes resembling the reported pro-inflammatory and anti-inflammatory MSC phenotypes. Furthermore, these priming strategies led to changes in the functional properties of ASCs, affecting their ability to migrate and modulate immune-mediated responses to prostate cancer cells in vitro.

      Conclusions

      TLR3 stimulation significantly decreased ASC migration, and TLR4 stimulation increased ASC immune-mediated killing potential against prostate cancer cells.

      Key Words

      Introduction

      Mesenchymal stromal cells (MSCs) are a heterogeneous multipotent stem cell population with self-renewal and stromal capabilities. MSCs can be isolated from many sources, including bone marrow, umbilical cord and adipose tissue [
      • Shi Y.
      • Wang Y.
      • Li Q.
      • Liu K.
      • Hou J.
      • Shao C.
      Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases.
      ], and the minimum criteria for their identification include adherence to plastic, specific antigen expression (CD73+, CD90+, CD105+, CD45–, CD34–, CD14–, CD79–, HLA-DR–) and multipotent differentiation into osteoblasts, adipocytes and chondroblasts [
      • Dominici M.
      • Blanc K.Le
      • Mueller I.
      • Slaper-Cortenbach I.
      • Marini F.
      • Krause D.
      • Deans R.
      • Keating A.
      • Prockop D.
      • Horwitz E.
      Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement.
      ]. MSCs can have roles in angiogenesis, remodeling of extracellular matrix, induction of differentiation of progenitor cells, tissue repair by paracrine action or direct differentiation and immunomodulation. These properties render them of interest for their potential use in various clinical applications, from inflammatory and autoimmune diseases to cancer [
      • Shi Y.
      • Wang Y.
      • Li Q.
      • Liu K.
      • Hou J.
      • Shao C.
      Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases.
      ,
      • Kim N.
      • Cho S.G.
      Clinical applications of mesenchymal stem cells.
      ].
      MSCs have been used in multiple clinical trials, and the results of these trials suggest that clinical use of these cells is safe [
      • Lalu M.M.
      • Mazzarello S.
      • Zlepnig J.
      • Dong Y.Y.R.
      • Montroy J.
      • McIntyre L.
      • Devereaux P.J.
      • Stewart D.J.
      • Mazer C.David
      • Barron C.C.
      • McIsaac D.I.
      • Fergusson D.A.
      Safety and Efficacy of Adult Stem Cell Therapy for Acute Myocardial Infarction and Ischemic Heart Failure (SafeCell Heart): A Systematic Review and Meta-Analysis.
      ,
      • Lalu M.M.
      • McIntyre L.
      • Pugliese C.
      • Fergusson D.
      • Winston B.W.
      • Marshall J.C.
      • Granton J.
      • Stewart D.J.
      • Group C.C.C.T.
      Safety of cell therapy with mesenchymal stromal cells (SafeCell): a systematic review and meta-analysis of clinical trials.
      ]. However, limited clinical data are available on the safety of MSCs as tools in the treatment of solid tumors. MSCs have been shown to demonstrate tumor tropism, because of which they are deemed candidate delivery vehicles for anti-cancer therapeutics. However, conflicting results have been found in pre-clinical cancer models with regard to the effect of MSC infusion on tumor progression [
      • Hmadcha A.
      • Martin-Montalvo A.
      • Gauthier B.R.
      • Soria B.
      • Capilla-Gonzalez V.
      Therapeutic Potential of Mesenchymal Stem Cells for Cancer Therapy.
      ]. Although reported studies differ in many aspects of their design, which could lead to the discrepancies observed in their results, MSC are responsive to micro-environmental changes [
      • Shi Y.
      • Wang Y.
      • Li Q.
      • Liu K.
      • Hou J.
      • Shao C.
      Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases.
      ], whereby “naive” MSCs may act in variable ways in response to the different environmental cues to which they are exposed within disease sites.
      Although MSCs are often described as immunosuppressive, this characteristic appears to not be inherent to these cells, as it has been reported that in the absence of inflammatory signals, MSCs lack the ability to suppress the immune response [
      Mesenchymal Stem Cell-Mediated Immunosuppression Occurs via Concerted Action of Chemokines and Nitric Oxide.
      ], but an immunosuppressive phenotype can be acquired upon exposure to inflammatory stimuli. However, some groups have reported a pro-inflammatory potential for MSCs [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ,
      • Li W.
      • Ren G.
      • Huang Y.
      • Su J.
      • Han Y.
      • Li J.
      • Chen X.
      • Cao K.
      • Chen Q.
      • Shou P.
      • Zhang L.
      • Yuan Z.R.
      • Roberts A.I.
      • Shi S.
      • Le A.D.
      • Shi Y.
      Mesenchymal stem cells: a double-edged sword in regulating immune responses.
      ]. This duality likely explains the conflicting effects of MSC infusion into cancer sites during disease progression, where the immunosuppressive activities of MSCs could potentially worsen disease progression, whereas a pro-inflammatory phenotype could provide an avenue for activation of the immune response and help in the clearance of tumor cells.
      An alternative to the infusion of “naive” MSCs is the pre-stimulation or “priming” of MSCs to enhance the desired therapeutic outcomes. This strategy has been shown to increase the therapeutic efficacy of MSCs in several pre-clinical models of disease [
      • Shi Y.
      • Wang Y.
      • Li Q.
      • Liu K.
      • Hou J.
      • Shao C.
      Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases.
      ]. However, the mechanisms involved in MSC phenotype modulation are incompletely understood. Toll-like receptor (TLR) stimulation has been shown to have a significant role in modulating MSC phenotypes, including leading to changes in the secretome, migration, and immunomodulation [
      • Chen X.
      • Zhang Z.Y.
      • Zhou H.
      • Zhou G.W.
      Characterization of mesenchymal stem cells under the stimulation of Toll-like receptor agonists.
      ,
      • DelaRosa O.
      • Lombardo E.
      Modulation of adult mesenchymal stem cells activity by toll-like receptors: implications on therapeutic potential.
      ,
      • Najar M.
      • Krayem M.
      • Meuleman N.
      • Bron D.
      • Lagneaux L.
      Mesenchymal Stromal Cells and Toll-Like Receptor Priming: A Critical Review.
      ,
      • Pevsner-Fischer M.
      • Morad V.
      • Cohen-Sfady M.
      • Rousso-Noori L.
      • Zanin-Zhorov A.
      • Cohen S.
      • Cohen I.R.
      • Zipori D.
      Toll-like receptors and their ligands control mesenchymal stem cell functions.
      ,
      • Tomchuck S.L.
      • Zwezdaryk K.J.
      • Coffelt S.B.
      • Waterman R.S.
      • Danka E.S.
      • Scandurro A.B.
      Toll-like receptors on human mesenchymal stem cells drive their migration and immunomodulating responses.
      ,
      • Sangiorgi B.
      • Panepucci R.A.
      Modulation of Immunoregulatory Properties of Mesenchymal Stromal Cells by Toll-Like Receptors: Potential Applications on GVHD.
      ,
      • Vega-Letter A.M.
      • Kurte M.
      • Fernández-O'Ryan C.
      • Gauthier-Abeliuk M.
      • Fuenzalida P.
      • Moya-Uribe I.
      • Altamirano C.
      • Figueroa F.
      • Irarrázabal C.
      • Carrión F.
      Differential TLR activation of murine mesenchymal stem cells generates distinct immunomodulatory effects in EAE.
      ]. TLR stimulation also has been reported to lead to polarizing changes in the cells, resulting in opposite roles in cancer progression, and this stimulation can be achieved specifically via short-term, low-level pre-exposure of human bone marrow-derived MSCs (BM-MSCs) to TLR4 or TLR3 ligands [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ,
      • Waterman R.S.
      • Henkle S.L.
      • Betancourt A.M.
      Mesenchymal stem cell 1 (MSC1)-based therapy attenuates tumor growth whereas MSC2-treatment promotes tumor growth and metastasis.
      ] TLR4 stimulation with lipopolysaccharide (LPS) promoted a pro-inflammatory MSC phenotype (MSC1) characterized by the upregulation of pro-inflammatory factors, which were correlated with permissive activation of T cells by MSCs in vitro and tumor growth reduction in a mouse model of ovarian cancer. Conversely, TLR3 stimulation with polyinosinic:polycytidylic acid (poly I:C) promoted an immunosuppressive MSC phenotype (MSC2), defined by the upregulation of immunosuppressive factors, which correlated with increased suppression of T cells in vitro and increased ovarian tumor growth and metastasis in the same mouse model.
      This phenotype duality as a consequence of distinct TLR stimulation has been described for human BM-MSCs but not for human adipose-derived MSCs (ASCs). MSCs from different sources have been shown to differ in some of their phenotypic and functional properties [
      • Shi Y.
      • Wang Y.
      • Li Q.
      • Liu K.
      • Hou J.
      • Shao C.
      Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases.
      ,
      • Raicevic G.
      • Najar M.
      • Stamatopoulos B.
      • De Bruyn C.
      • Meuleman N.
      • Bron D.
      • Toungouz M.
      • Lagneaux L.
      The source of human mesenchymal stromal cells influences their TLR profile as well as their functional properties.
      ]. ASCs are of significant interest pre-clinically and clinically because this MSC subpopulation provides several advantages over their bone marrow counterparts as a result of their greater abundance, relative ease of extraction and stable propagation at the low passages necessary for safe therapeutic applications [
      • El Atat O.
      • Antonios D.
      • Hilal G.
      • Hokayem N.
      • Abou-Ghoch J.
      • Hashim H.
      • Serhal R.
      • Hebbo C.
      • Moussa M.
      • Alaaeddine N.
      An Evaluation of the Stemness, Paracrine, and Tumorigenic Characteristics of Highly Expanded, Minimally Passaged Adipose-Derived Stem Cells.
      ,
      • Kern S.
      • Eichler H.
      • Stoeve J.
      • Klüter H.
      • Bieback K.
      Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue.
      ]. Thus, we aimed to evaluate the effect of short-term, low-level exposure of ASCs to TLR agonists and the potential role of ASC “polarization” in the functional properties of these cells as candidate tools for prostate cancer therapeutic applications in which they may, for example, be utilized to deliver secreted proteins (cytokines, chemokines, growth factors).

      Methods

      Cell culture

      Human ASCs and BM-MSCs (hASC-01D and OS-102-01, respectively) from male Caucasian donors (age, 65–72 years old, body mass index, 33–34) were obtained from Obatala Sciences (New Orleans, LA, USA). ASCs were cultured on fibronectin-coated plasticware in modified medium (ASC medium) [
      • Shearer J.J.
      • Wold E.A.
      • Umbaugh C.S.
      • Lichti C.F.
      • Nilsson C.L.
      • Figueiredo M.L.
      Inorganic Arsenic-Related Changes in the Stromal Tumor Microenvironment in a Prostate Cancer Cell-Conditioned Media Model.
      ]. Human BM-MSCs were cultured in StromalQual Stromal Basal Medium (OS-001-02; Obatala Sciences) supplemented with 10% fetal bovine serum (FBS) (HyClone; Cytiva, Marlborough, MA, USA) and 1X antibiotic–antimycotic (Anti-Anti) (Thermo Fisher Scientific, Waltham, MA, USA). All priming experiments were conducted using cells with a passage number ≤6. The human prostate cancer cell line PC3 was obtained from American Type Culture Collection (Manassas, VA, USA) and maintained in Roswell Park Memorial Institute (RPMI) 1640 medium (Corning, Durham, NC, USA) supplemented with 10% FBS and 1X Anti-Anti. Nuclei of PC3 cells were fluorescently labeled with Nuclight Red Lentivirus Reagent (Essen BioScience, Ann Arbor, MI, USA) at a multiplicity of infection of 3. Passaging and cell collection were performed by trypsinization. Cryopreserved peripheral blood mononuclear cells (PBMCs) from healthy adult donors were purchased from Cellero (Bothell, WA, USA) and STEMCELL Technologies (Seattle, WA, USA). Prior to use, PBMCs were thawed and allowed to recover overnight in complete RPMI medium. After recovery, plates were gently scraped with a cell scraper to lift adherent cell subsets.

      MSC priming

      MSCs were thawed and expanded as described. After expansion, MSCs were seeded in non-coated six-well plates at a density of 3 × 105 cells/well and allowed to attach overnight in complete medium. MSCs were primed for 1 h in priming medium containing Dulbecco's Modified Eagle's Medium/Nutrient Mixture F-12 Ham (Corning) supplemented with 16.5% FBS (American Type Culture Collection) and 1X Anti-Anti. Unprimed MSCs incubated in priming medium were used as a control. For TLR priming, poly I:C 1 µg/mL (Sigma-Aldrich, St Louis, MO, USA) or LPS 10 ng/mL (MilliporeSigma, Burlington, MA, USA) was added to the priming medium as an agonist [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ]. After 1 h, cell cultures were washed twice with medium and utilized for further experimentation or analysis.

      RNA isolation

      After the removal of priming agonists, we incubated primed MSCs for 6 h or 18 h in priming medium and collected cell pellets for subsequent RNA isolation. RNA isolation was performed using the RNeasy Kit (QIAGEN, Germantown, MD, USA).

      NanoString nCounter analysis

      RNA samples were processed by the Research Technology Support Facility Genomics Core at Michigan State University (East Lansing, MI, USA) using the nCounter Human Immunology Panel (NanoString, Seattle, WA, USA). Briefly, total RNA was mixed with nCounter CodeSet probes and hybridized overnight. The excess was then removed and CodeSet/RNA complexes were immobilized in the nCounter cartridge. Data were collected in nCounter Digital Analyzer, where fluorescent CodeSet probes acted as “barcodes” for counting the target RNA. Data were processed using nSolver 4.0 analysis software (NanoString). Briefly, background thresholding was performed with a threshold count value of 20 (default), and fold change estimation was calculated via partitioning by treatment group relative to unprimed control for each time point. Enrichment analysis of differentially expressed genes (|fold change| ≥1.2, P< 0.05) was performed July 10, 2021, using ClustVis [
      • Metsalu T.
      • Vilo J.
      ClustVis: a web tool for visualizing clustering of multivariate data using principal component analysis and heatmap.
      ] and Metascape [
      • Zhou Y.
      • Zhou B.
      • Pache L.
      • Chang M.
      • Khodabakhshi A.H.
      • Tanaseichuk O.
      • Benner C.
      • Chanda S.K.
      Metascape provides a biologist-oriented resource for the analysis of systems-level datasets.
      ].

      Protein quantification via enzyme-linked immunosorbent assay

      ASCs were primed as described earlier and then washed using two medium washes. Culture medium was replaced and cells were incubated for 24 h prior to culture-conditioned medium (CCM) collection. Samples were evaluated using the RayBio Human IL-8 (CXCL8) ELISA Kit (RayBiotech Life, Inc, Peachtree Corners, GA, USA) and IP-10/CXCL10 Human Instant ELISA Kit (Thermo Fisher Scientific) per the manufacturers’ instructions. Absorbance was read by a GloMax plate reader (Promega Corporation, Madison, WI, USA).

      Reverse transcription quantitative polymerase chain reaction

      Reverse transcription was performed for 0.5 µg of each RNA sample using amfiRivert Platinum cDNA Synthesis Master Mix (GenDEPOT, Katy, TX, USA). Reverse transcription quantitative polymerase chain reaction contained 1 µL complementary DNA template, 2× SYBR Green Master Mix (Thermo Fisher Scientific) and 1 µM forward and reverse primers for target genes or beta-actin (Integrated DNA Technologies, Coralville, IA, USA) as a housekeeping control (Table 1). Reverse transcription quantitative polymerase chain reaction was performed in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) using the following conditions: 95°C for 3 min and 40 cycles of 95°C for 3 s, 60°C for 30 s and 72°C for 19 s. Data acquisition was performed with QuantStudio 3 software (Thermo Fisher Scientific).
      Table 1Reverse transcription quantitative polymerase chain reaction primers.
      Target geneSequence
      β-actinForward: AGAAGGATTCCTATGTGGGCG

      Reverse: CATGTCGTCCCAGTTGGTGAC
      CCL20Forward: TGCTGTACCAAGAGTTTGCTC

      Reverse: CGCACACAGACAACTTTTTCTTT
      CCL5Forward: CCAGCAGTCGTCTTTGTCAC

      Reverse: CTCTGGGTTGGCACACACTT
      CXCL10Forward: GTGGCATTCAAGGAGTACCTC

      Reverse: TGATGGCCTTCGATTCTGGATT
      IDO1Forward: CATCTGCAAATCGTGACTAAG

      Reverse: CAGTCGACACATTAACCTTCCTTC
      IL4Forward: CGGCAACTTTGTCCACGGA

      Reverse: TCTGTTACGGTCAACTCGGTG
      IL6Forward: AGTGCCTCTTTGCTGCTTTCACAC

      Reverse: AGCCACTCACCTCTTCAGAACGAA
      IL8Forward: ACTGAGAGTGATTGAGAGTGGAC

      Reverse: AACCCTCTGCACCCAGTTTTC
      NANOGForward: TTTGTGGGCCTGAAGAAAACT

      Reverse: AGGGCTGTCCTGAATAAGCAG
      SOX2Forward: GCCGAGTGGAAACTTTTGTCG

      Reverse: GGCAGCGTGTACTTATCCTTCT
      TGFβ1Forward: CAATTCCTGGCGATACCTCAG

      Reverse: GCACAACTCCGGTGACATCAA

      Differentiation assays

      ASC differentiation was assessed utilizing a Human Mesenchymal Stem Cell Functional Identification Kit (SC006; R&D Systems, Minneapolis, MN, USA). Briefly, to assess osteogenic differentiation, 7.4 × 103 cells/well were seeded in a fibronectin-coated 24-well plate and cultured until 70% confluency. When desired confluency was reached, cells were primed as previously described, after which medium was replaced with 0.5 mL of osteogenic differentiation medium. Medium was replaced every 3–4 days. At day 18, cells were washed with phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde in PBS for 20 min at room temperature prior to immunostaining. Immunostaining was performed with the following antibodies and conditions after permeabilization and blocking: 10 µg/mL of anti-osteocalcin primary antibody overnight at 4°C and donkey anti-mouse IgG NL637 secondary antibody (NL008; R&D Systems) for 1 h. To evaluate adipogenic differentiation, 3.7 × 104 cells/well were seeded in a 24-well plate and cultured until 100% confluency. Upon confluency, cells were primed as previously described, after which medium was replaced with 0.5 mL of adipogenic differentiation medium. Medium was replaced every 3–4 days. At day 21, cells were washed with PBS and fixed with 4% paraformaldehyde in PBS for 20 min at room temperature prior to immunostaining. Immunostaining was performed with the following antibodies and conditions after permeabilization and blocking: 10 µg/mL of anti-mFABP4 primary antibody overnight at 4°C and donkey anti-goat IgG NL637 secondary antibody (NL002; R&D Systems) for 1 h.

      Data acquisition

      Phase contrast and fluorescent imaging in the far red channel (200×) was acquired for each well using a DMi8 microscope and Leica Application Suite X software (Leica Microsystems, Wetzlar, Germany). Acquired images were processed and analyzed using ImageJ (National Institutes of Health, Bethesda, MD, USA).

      Transwell migration assay

      PC3 cells were seeded in 24-well plates at a density of 1.5 × 105 cells/well and incubated in priming medium overnight. AMSCs were TLR-primed and transferred after agonist removal into 8-µm Transwell inserts (Corning) at a density of 1.5 × 104 cells/insert, and the inserts were placed into wells previously seeded with PC3 cells or medium alone as a control. Cells were allowed to migrate overnight (18 h). Migrated cells (at bottom face of membrane) were assessed after fixation with 10% buffered formalin. Briefly, culture medium in the plates was replaced with 10% buffered formalin, then plates were incubated for 15 min and washed with distilled water. Membranes were removed from the inserts and placed on slides for staining and further analysis. Membranes were stained using VECTASHIELD HardSet Antifade Mounting Medium with 4′,6-diamidino-2-phenylindole (Vector Laboratories, Burlingame, CA, USA) and imaged at 10× with an IX71 inverted microscope (Olympus, Center Valley, PA, USA). Assessment of migratory cells was performed via ImageJ analysis.

      Cell proliferation assay

      Nuclight Red-labeled PC3 (Red-PC3) cells were seeded in 96-well plates at a density of 1.5 × 103 cells/well and incubated in medium overnight. ASCs were primed and added to wells containing Red-PC3 cells at 20%, 10% or 1% of the original Red-PC3 seeding density. Wells were imaged for phase and red channels using Incucyte live imaging (Essen BioScience) right after the addition of AMSCs and every 2 h following baseline measurements for a period of 3 days. Proliferation was measured as a ratio of red object counts over time relative to baseline counts.

      Scratch wound migration assay

      Red-PC3 cells were seeded in 96-well plates at a density of 7 × 104 cells/well in co-culture (co-mixed) with 20%, 10% or 1% of primed ASCs relative to Red-PC3 seeding density and allowed to incubate for 8 h. The cell monolayer was “scratched” using the WoundMaker tool (Essen BioScience), and lifted cells were washed off prior to imaging. Wells were imaged using Incucyte live imaging every 2 h following baseline measurements for a period of 3 days. Migration was assessed by evaluating wound gap size relative to baseline over time.

      Immune cell killing assay

      Red-PC3 cells were seeded in 96-well plates at a density of 2000 cells/well and allowed to attach overnight. Medium in wells was replaced with fresh RPMI medium containing Caspase-3/7 Green Dye for Apoptosis (Essen BioScience) for cell assay. Treatment groups included none (untreated control), some or all of the following components: 0.01 µg/mL recombinant human IL-2 (589102; BioLegend, San Diego, CA, USA), 0.1 ug/mL OKT3 purified anti-human CD3 antibody (anti-CD3) (317301; BioLegend), 10 000 cells/well PBMCs and ASCs (unprimed, poly I:C-primed, LPS-primed; 400, 200 or 20 cells/well). Wells were imaged using Incucyte live imaging every 2 h following baseline measurements for a period of 5 days. Survival to immune killing was measured as a ratio of red-only object counts (red – red/green overlap) over time relative to baseline counts.

      Statistical analysis

      Data are presented as the mean of triplicate samples and experiments. Prism 9.1.2 (GraphPad Software, San Diego, CA, USA) for Windows (Microsoft Corporation, Redmond, WA, USA) was used to calculate statistically significant differences among groups using multiple t-tests or analysis of variance. P < 0.05 was considered significant.

      Results

      Priming of ASCs with poly I:C or LPS leads to divergent gene expression profiles with differences in relative expression of immunomodulatory factors

      To investigate whether adipose tissue can serve as an alternative source of MSCs capable of undergoing polarization into MSC1 or MSC2 populations upon priming with small molecules, human ASCs were primed using short-term exposure to TLR agonists at low small-molecule concentrations reported to be sufficient by Waterman et al.[
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ] for inducing MSC TLR-based priming. RNA extracted from primed ASC pellets was analyzed using a NanoString nCounter Human Immunology gene expression assay to identify potential signature gene expression changes occurring in these cells upon priming relative to unprimed controls (Figure 1). We used nSolver 4.0 analysis software. Of the 594 genes in the nCounter panel utilized, we identified 117 differentially expressed genes in one or more groups (Figure 1A).
      Fig 1
      Fig. 1Heat map of differentially expressed genes upon ASC priming with TLR agonists. NanoString nCounter Human Immunology gene expression assay was performed on ASC samples treated with TLR agonists for 1 h (poly I:C 1 µg/mL or LPS 10 ng/mL) followed by 6 h or 18 h of incubation in complete culture medium. A total of 117 of 594 genes analyzed using nSolver analysis software were found to be differentially expressed across groups. Data are presented as fold change relative to unprimed control (n = 3). Genes considered differentially expressed demonstrated |fold change| ≥1.2 and P < 0.05. Genes were clustered by average linkage and Euclidean distance via ClustVis
      [
      • Metsalu T.
      • Vilo J.
      ClustVis: a web tool for visualizing clustering of multivariate data using principal component analysis and heatmap.
      ]
      , and heat maps were generated utilizing Prism. (A) All treatment groups. (B) LPS-primed groups. (C) Poly I:C-primed groups.
      LPS priming resulted in differential expression of 20 genes across the 6- and 18-h time points, among which CCL20, IL8 and CCL5 were found to have the highest upregulation at 6 h after removal of the priming stimulus (Figure 1B). Notably, most of the differentially expressed genes at the 6-h time point returned to baseline expression by 18 h after LPS removal, suggesting a likely transient “commitment” of ASCs to a functional role that gets reversed in the absence of a stimulus. For poly I:C-primed ASCs, 112 genes were found to be differentially expressed across both time points (Figure 1C). Some of the most upregulated genes in the panel were CXCL10, CXCL11, IDO1, TNFSF10 and CCL5. Although by 18 h some genes were observed to be upregulated at a lesser magnitude (i.e., CXCL10, IDO1) or to have returned to baseline expression levels (i.e., CX3CL1), others increased in expression (i.e., IRF7) or were observed to be upregulated (i.e., HLA-DRA) relative to the 6-h time point.
      When evaluating the expression of genes associated with the MSC1 and MSC2 polarization signatures (see supplementary Figure 1A) [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ], we observed some similarities to and differences from what has been reported for human bone marrow-derived MSCs. LPS stimulation resulted in upregulation of IL8 but not IL6 in our ASC samples. Poly I:C priming resulted in upregulation of CXCL10, CCL5, and IDO1 but did not promote differential expression of TGFβ, IL10 or IL4. Overall, the gene expression signatures observed suggest that there were distinct ASC signatures associated with the stimulation provided by these agonists, although some of the gene expression changes overlapped across treatments (Figure 2B,C).
      Fig 2
      Fig. 2Relative expression and ontology analysis of differentially expressed genes upon ASC priming with TLR agonists. (A) Clustering analysis of significantly differentially expressed genes (as per NanoString nCounter Human Immunology gene expression assay) was performed via ClustVis
      [
      • Metsalu T.
      • Vilo J.
      ClustVis: a web tool for visualizing clustering of multivariate data using principal component analysis and heatmap.
      ]
      . Unit variance scaling is applied to rows. Both rows and columns are clustered using Euclidean distance and average linkage. Tree ordering is organized by tightest cluster first. (B,C) Venn diagram of genes differentially expressed across treatment groups, showing gene expression change overlap across groups, was generated using the Van de Peer Lab Venn diagram tool (http://bioinformatics.psb.ugent.be/webtools/Venn/). (D–G) Enriched ontology clusters generated via Metascape
      [
      • Zhou Y.
      • Zhou B.
      • Pache L.
      • Chang M.
      • Khodabakhshi A.H.
      • Tanaseichuk O.
      • Benner C.
      • Chanda S.K.
      Metascape provides a biologist-oriented resource for the analysis of systems-level datasets.
      ]
      upon input of upregulated genes for each treatment group showing up to top 20 statistically enriched clusters.
      Gene clustering analysis (Figure 2A) facilitated the assessment of relative expression of genes across groups. This highlighted relatively higher expression of pro-inflammatory cytokines and chemokines in LPS-stimulated groups (i.e., CCL20, CXCL1, IL8), supporting a pro-inflammatory shift of ASCs in line with observations by Waterman et al.[
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ] with regard to BM-MSCs. By contrast, poly I:C stimulation appeared to be associated with a more anti-inflammatory phenotype, as implied by the relative higher expression of genes such as IDO1, CXCL10 and CXCL9, which have been reported by others to have roles in MSC-mediated immunosuppression [
      • Shi Y.
      • Wang Y.
      • Li Q.
      • Liu K.
      • Hou J.
      • Shao C.
      Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases.
      ,
      Mesenchymal Stem Cell-Mediated Immunosuppression Occurs via Concerted Action of Chemokines and Nitric Oxide.
      ,
      • Kadle R.L.
      • Abdou S.A.
      • Villarreal-Ponce A.P.
      • Soares M.A.
      • Sultan D.L.
      • David J.A.
      • Massie J.
      • Rifkin W.J.
      • Rabbani P.
      • Ceradini D.J.
      Microenvironmental cues enhance mesenchymal stem cell-mediated immunomodulation and regulatory T-cell expansion.
      ]. Similarly, when assessing protein secretion, we observed the highest upregulation in IL-8 and CXCL10/IP-10 following LPS priming and poly I:C priming, respectively (see supplementary Figure 2). Interestingly, the highest expression of these genes was observed at the 6-h time point. At the 18-h time point, many different genes increased in expression, including several members of the HLA complex (Figure 2A; also see supplementary Figure 1B).
      Ontology enrichment analysis performed via Metascape (Figure 2D–G) also indicated potential functional differences across treatment groups. Poly I:C-upregulated genes were found to be related to several immune processes, including regulation of cytokine production and the defense response, negative regulation of the immune system process and activation of myeloid leukocytes, at the 6-h time point (Figure 2D). Although many of these processes were also enriched at the 18-h time point (Figure 2E), processes that may be associated with immune activation were only enriched at this later time point, including positive regulation of immune response and processes related to lymphocyte activation. Identified ontology enrichment clusters were fewer in the LPS-treated groups, likely due to fewer input upregulated genes, but the processes identified included processes suggesting activation of the immune response at 6 h (Figure 2F) and cell adhesion regulation at 18 h (Figure 2G).
      Taken together, our data suggest that poly I:C and LPS priming of ASCs results in different gene expression profiles with some overlapping elements. Compared with previously reported MSC1 and MSC2 phenotypes, ASCs appear to follow the polarization paradigm, in that LPS priming results in relative expression of genes and processes associated with a pro-inflammatory phenotype, whereas poly I:C priming results in the highest expression of immunosuppressive genes and processes at the 6-h time point. There are, however, differences in other MSC1/MSC2 polarization-related gene expression profiles, which could contribute to functional differences between these cells that might be dependent on their tissue source.

      TLR priming is transient and does not in itself result in a commitment to lineage differentiation

      Although MSCs have the ability to differentiate into multiple cell types, many believe that their primary role in tissue repair and immunomodulation occurs through the secretion of paracrine factors and not by direct cell replacement through differentiation [
      • Betancourt A.M.
      • Waterman R.S.
      The Role of Mesenchymal Stem Cells in the Tumor Microenvironment, Tumor Microenvironment and Myelomonocytic Cells.
      ]. This would suggest that priming strategies that allow MSCs to maintain their stemness could provide a clinical advantage in application of these cells. In line with this, stemness is believed to play a role in the immunogenicity, survival and efficacy of MSCs in vivo [
      • Rowland A.L.
      • Xu J.J.
      • Joswig A.J.
      • Gregory C.A.
      • Antczak D.F.
      • Cummings K.J.
      • Watts A.E.
      In vitro MSC function is related to clinical reaction in vivo.
      ]. In other reports, TLR stimulation has been shown to have an effect on the stemness of MSCs, impacting their ability to differentiate into different lineages and self-renew [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ]. In the NanoString gene expression assessment, we observed many genes that were affected by TLR priming. Although some of the changes seemed to be reversible, others did not. This raises the question of whether AMSCs lose their stemness and permanently “commit” to a specific role upon TLR priming; thus, we assessed the expression of embryonic markers as an indicator of stemness in ASCs.
      NANOG and SOX2 have been reported as having roles in the regulation of MSC multipotency, self-renewal and plasticity [
      • Yoon D.S.
      • Kim Y.H.
      • Jung H.S.
      • Paik S.
      • Lee J.W.
      Importance of Sox2 in maintenance of cell proliferation and multipotency of mesenchymal stem cells in low-density culture.
      ,
      • Kolf C.M.
      • Cho E.
      • Tuan R.S.
      Mesenchymal stromal cells. Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation.
      ,
      • Tsai C.C.
      • Su P.F.
      • Huang Y.F.
      • Yew T.L.
      • Hung S.C.
      Oct4 and Nanog directly regulate Dnmt1 to maintain self-renewal and undifferentiated state in mesenchymal stem cells.
      ]. The expression of these genes was assessed following TLR priming (Figure 3A). For both genes, we observed downregulation in their expression at 6 h post-priming with poly I:C or LPS. At the later priming time point (18 h), expression of NANOG returned to baseline levels and SOX2 was slightly upregulated. This transient reduction rather than loss of ASC stemness in response to TLR agonists suggests that our priming approach did not result in a definitive commitment of ASCs toward differentiation, but rather temporarily changed their phenotype in response to the stimuli.
      Fig 3
      Fig. 3Evaluation of stemness properties following TLR priming. (A) RT-qPCR was performed on RNA isolated from ASC samples treated with TLR agonists for 1 h (poly I:C 1 µg/mL or LPS 10 ng/mL) followed by 6 h or 18 h of incubation in culture medium. Gene expression is presented as mean fold change relative to unprimed ASC control ± SD (n = 3). Statistical significance was assessed by two-tailed t-tests. (B) Quantification of differentiation marker expression in ASCs induced to differentiate after short-term, low-level TLR priming in the presence (+) or absence (–) of differentiation supplements. Data are presented as percentage area ± SD (n ≥6). No statistically significant differences were observed across priming groups upon assessment by two-tailed t-tests. (C,D) Representative phase contrast and grayscale immunofluorescence images (20× magnification) of (C) osteogenesis and (D) adipogenesis differentiation assays. Contrast of immunofluorescence images was enhanced via ImageJ for easier visualization. *P < 0.05. rel., relative; RT-qPCR, reverse transcription quantitative polymerase chain reaction; SD, standard deviation.
      We further explored the effects of TLR priming on ASC stemness by means of differentiation assays following TLR priming (Figure 3B–D). In these assays, no significant differences were observed in the expression of differentiation markers across ASC priming groups for either osteogenic or adipogenic differentiation assays. These results further support the conclusion that the priming conditions evaluated did not promote a differentiation commitment, as primed AMSCs remained capable of undergoing differentiation with similar efficacy to the unprimed controls.

      Poly I:C but not LPS priming affects migration of ASCs toward prostate cancer cells

      MSCs are often viewed as potential cellular-based agents or vehicles for the delivery of cancer therapies [
      • Betancourt A.M.
      • Waterman R.S.
      The Role of Mesenchymal Stem Cells in the Tumor Microenvironment, Tumor Microenvironment and Myelomonocytic Cells.
      ], largely due to their ability to home to tumor sites much as they home to injury sites. MSC migration and invasion have been reported to be modulated by different priming strategies, including TLR stimulation [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ,
      • Tomchuck S.L.
      • Zwezdaryk K.J.
      • Coffelt S.B.
      • Waterman R.S.
      • Danka E.S.
      • Scandurro A.B.
      Toll-like receptors on human mesenchymal stem cells drive their migration and immunomodulating responses.
      ].
      In the interest of investigating the potential effects of TLR priming on the ability of ASCs to migrate toward prostate cancer cells, we evaluated this process using a transwell migration assay (Figure 4). The migration of ASCs was increased by the presence of PC3 cells in all groups. This suggests that ASCs maintained the ability to home toward prostate cancer cells upon TLR priming. However, migration capability was diminished by pre-treatment of ASCs with poly I:C, as this resulted in significantly fewer ASCs migrating through the permeable Transwell insert membranes. In this experimental setup, LPS priming did not have a significant effect on ASC migration.
      Fig 4
      Fig. 4Assessment of ASC migration toward prostate cancer cells following TLR priming. Transwell migration assay was performed with primed ASCs seeded in the top chamber. ASC migration toward medium or PC3 cells and their secreted factors were assessed after 18 h by imaging migratory cells at the bottom of the membranes. Data are presented as mean ± SD (n = 3). Analysis was performed using Student's t-tests. *P < 0.05. Rel., relative; ns., not significant (P ≥ 0.05); SD, standard deviation.

      TLR priming of ASCs does not directly impact prostate cancer cell proliferation or migration

      Although MSCs are viewed as potential therapeutic tools in cancer, the prospective safety of these cells is questioned as a result of conflicting results in the literature regarding their effect on tumor progression [
      • Hmadcha A.
      • Martin-Montalvo A.
      • Gauthier B.R.
      • Soria B.
      • Capilla-Gonzalez V.
      Therapeutic Potential of Mesenchymal Stem Cells for Cancer Therapy.
      ,
      • Betancourt A.M.
      • Waterman R.S.
      The Role of Mesenchymal Stem Cells in the Tumor Microenvironment, Tumor Microenvironment and Myelomonocytic Cells.
      ,
      • Cheng S.
      • Nethi S.K.
      • Rathi S.
      • Layek B.
      • Prabha S.
      Engineered Mesenchymal Stem Cells for Targeting Solid Tumors: Therapeutic Potential beyond Regenerative Therapy.
      ,
      • Nowakowski A.
      • Drela K.
      • Rozycka J.
      • Janowski M.
      • Lukomska B.
      Engineered Mesenchymal Stem Cells as an Anti-Cancer Trojan Horse.
      ,
      • Rivera-Cruz C.M.
      • Shearer J.J.
      • Figueiredo Neto M.
      • Figueiredo M.L.
      The Immunomodulatory Effects of Mesenchymal Stem Cell Polarization within the Tumor Microenvironment Niche.
      ]. With the goal of assessing the potential role of TLR priming in the modulation of direct interaction between ASCs and prostate cancer cells, we performed co-culture proliferation and migration assays utilizing Incucyte live cell imaging (Figure 5) to evaluate the proliferation and migration of prostate cancer cells upon exposure to unprimed or TLR-primed ASCs.
      Fig 5
      Fig. 5Assessment of direct effects of ASCs on prostate cancer cell proliferation and migration with ASC-PC3 in co-culture (co-mix) assays following TLR priming. (A) Red-PC3 cell proliferation in co-culture (co-mixed) with TLR-primed ASCs (10:1 ratio) was assessed over time with Incucyte live cell imaging by evaluating cell counts of Red-labeled cells relative to cell count at the start of the experiment. (B) Migration of Red-PC3 cells was assessed by scratch wound migration assay, measuring relative gap size over time. Data are presented as mean ± SD (n = 4). rel., relative; SD, standard deviation.
      We observed no significant differences in proliferation in TLR-primed groups relative to unprimed and no ASC controls for a period of 3 days (Figure 5A). Upon assessing the migration of Red-PC3 cells via a scratch wound migration assay, we did not observe any significant differences in PC3 migration over a period of 3 days in TLR-primed groups relative to unprimed and no ASC controls (Figure 5B). Overall, our results suggest that TLR priming of ASCs did not affect their direct interaction with PC3 cells, in that priming did not appear to augment tumor cell proliferation or migration.

      TLR priming of ASCs affects their ability to modulate immune-mediated killing of prostate cancer cells

      Another functional role of MSCs reported to be influenced by TLR engagement is their ability to impact immunomodulation [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ]. The tumor microenvironment is composed of extracellular matrix components and non-tumor stromal cells. Within these cell populations are many immune cells that may contribute to tumor progression or clearance depending on their activation state. MSCs have been shown to modulate the proliferation and activation of many immune cell subtypes, including cells associated with innate and adaptive immunity [
      • Rivera-Cruz C.M.
      • Shearer J.J.
      • Figueiredo Neto M.
      • Figueiredo M.L.
      The Immunomodulatory Effects of Mesenchymal Stem Cell Polarization within the Tumor Microenvironment Niche.
      ]. Although we did not find any evidence that TLR priming directly affected the ability of ASCs to modulate the proliferation and migration of prostate cancer cells (Figure 5), other indirect mechanisms, such as modulation of tumor cell survival via immunomodulation, were not part of the experimental design of these assays. To assess the potential role of TLR priming in the immune-mediated modulation of cancer cell survival, we performed an immune cell killing assay using Incucyte live cell imaging (Figure 6).
      Fig 6
      Fig. 6Assessment of effect of ASC priming on immune cell killing of prostate cancer cells. (A–C) Proliferation of non-apoptotic PC3 cells when co-cultured (co-mixed) with PBMCs in the presence or absence of ASCs as well as immunostimulatory signals assessed over time by Incucyte live cell imaging. (D) AUC of non-apoptotic PC3 cells. Data are presented as mean ± SD (n = 3). Analysis was performed using one-way ANOVA compared with no ASC controls. *P < 0.05. ANOVA, analysis of variance; AUC, area under the curve; SD, standard deviation.
      In the absence of immunostimulatory signals (Figure 6A), a slight decrease in proliferation rate was observed in groups containing LPS-primed AMSCs relative to no AMSC controls after 2 days of assessment. The presence of either unprimed or poly I:C-primed AMSCs had no significant effect on the proliferation and survival of PC3 cells under these conditions.
      In the presence of IL-2 (Figure 6B,D), the proliferation rate for all treatment groups decreased significantly compared with the no stimulus control. The proliferation effect was expected, as IL-2 plays a role in the activation of some immune subsets present within PBMCs (i.e., natural killer [NK] cells) [
      • Abbas A.K.
      • Trotta E.
      • Simeonov D.R
      • Marson A.
      • Bluestone J.A.
      Revisiting IL-2: Biology and therapeutic prospects.
      ]. The presence of LPS-stimulated ASCs significantly decreased the proliferation rate of PC3 cells, except when added at a ratio of 1:10 ASCs to PC3 cells.
      When both IL-2 and anti-CD3 were present as immunostimulatory agents (Figure 6C,D), the proliferation rate of PC3 tumor cells decreased significantly for all groups compared with the no stimulus and IL-2-only groups. Under these conditions, LPS-primed ASCs maintained the ability to reduce PC3 tumor cell proliferation rate relative to controls (no ASCs or unprimed ASCs), seen as a significant increase in cancer cell killing in all treatment groups.
      Taken together, our data suggest that TLR priming impacts the ability of ASCs to modulate immune-mediated killing of prostate cancer cells. Although the role of ASCs in the immune-mediated killing of prostate cancer cells varied depending on the immunostimulatory signals present, it appears that LPS priming more consistently supports the clearance of cancer cells by PBMCs in our assays.

      Discussion

      The paradigm of MSC polarization via TLR stimulation was proposed in 2010 by Waterman et al.[
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ]. Although this concept could inform new strategies for application of MSCs, the supporting observations are limited to human or murine BM-MSCs [
      • Vega-Letter A.M.
      • Kurte M.
      • Fernández-O'Ryan C.
      • Gauthier-Abeliuk M.
      • Fuenzalida P.
      • Moya-Uribe I.
      • Altamirano C.
      • Figueroa F.
      • Irarrázabal C.
      • Carrión F.
      Differential TLR activation of murine mesenchymal stem cells generates distinct immunomodulatory effects in EAE.
      ]. MSCs can be isolated from a variety of tissues, including bone marrow, placenta, umbilical cord and adipose tissue [
      • Berebichez-Fridman R.
      • Montero-Olvera P.R.
      Sources and Clinical Applications of Mesenchymal Stem Cells: State-of-the-art review.
      ]. Although all MSCs share common characteristics, including multipotency, specific surface marker expression profile and adherence to plastic [
      • Dominici M.
      • Blanc K.Le
      • Mueller I.
      • Slaper-Cortenbach I.
      • Marini F.
      • Krause D.
      • Deans R.
      • Keating A.
      • Prockop D.
      • Horwitz E.
      Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement.
      ], MSCs from different sources also have varying functional potential and may differ in their inherent expression profile of certain molecules and receptors, including TLRs [
      • Raicevic G.
      • Najar M.
      • Stamatopoulos B.
      • De Bruyn C.
      • Meuleman N.
      • Bron D.
      • Toungouz M.
      • Lagneaux L.
      The source of human mesenchymal stromal cells influences their TLR profile as well as their functional properties.
      ].
      Although other groups have assessed some of the phenotypic and functional effects associated with stimulating TLR in ASCs [
      • Raicevic G.
      • Najar M.
      • Stamatopoulos B.
      • De Bruyn C.
      • Meuleman N.
      • Bron D.
      • Toungouz M.
      • Lagneaux L.
      The source of human mesenchymal stromal cells influences their TLR profile as well as their functional properties.
      ,
      • Raicevic G.
      • Najar M.
      • Pieters K.
      • De Bruyn C.
      • Meuleman N.
      • Bron D.
      • Toungouz M.
      • Lagneaux L.
      Inflammation and Toll-like receptor ligation differentially affect the osteogenic potential of human mesenchymal stromal cells depending on their tissue origin.
      ,
      • Cho H.Hwa
      • Bae Y.C.
      • Jung J.S.
      Role of Toll-like receptors on human adipose-derived stromal cells.
      ,
      • Lombardo E.
      • DelaRosa O.
      • Mancheño-Corvo P.
      • Menta R.
      • Ramírez C.
      • Büscher D.
      Toll-like receptor-mediated signaling in human adipose-derived stem cells: implications for immunogenicity and immunosuppressive potential.
      ,
      • Jafari M.
      • Asghari A.
      • Delbandi A.A.
      • Jalessi M.
      • Jazayeri M.H.
      • Samarei R.
      • Tajik N.
      Priming TLR3 and TLR4 in human adipose- and olfactory mucosa-derived mesenchymal stromal cells and comparison of their cytokine secretions.
      ,
      • Herzmann N.
      • Salamon A.
      • Fiedler T.
      • Peters K.
      Lipopolysaccharide induces proliferation and osteogenic differentiation of adipose-derived mesenchymal stromal cells in vitro via TLR4 activation.
      ,
      • Lee S.C.
      • Jeong H.J.
      • Lee S.K.
      • Kim S.J.
      Lipopolysaccharide preconditioning of adipose-derived stem cells improves liver-regenerating activity of the secretome.
      ,
      • Fiedler T.
      • Salamon A.
      • Adam S.
      • Herzmann N.
      • Taubenheim J.
      • Peters K.
      Impact of bacteria and bacterial components on osteogenic and adipogenic differentiation of adipose-derived mesenchymal stem cells.
      ,
      • Huh J.E.
      • Lee S.Y.
      IL-6 is produced by adipose-derived stromal cells and promotes osteogenesis.
      ], to the best of our knowledge, the differential impact of TLR priming on the immunomodulatory potential of ASCs has not yet been reported. The current knowledge regarding TLR stimulation of MSCs and the impact on gene expression is summarized in Table 2. Through the NanoString gene expression profile assessment, we were able to identify some similarities to gene expression changes described with the MSC1 and MSC2 polarization paradigm, previously reported for BM-MSCs. In agreement with Waterman et al. [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ], we detected upregulation of pro-inflammatory factors (i.e., IL8) with LPS priming as well as upregulation of factors previously reported to be important for MSC-mediated immunosuppression (i.e., IDO, CXCL10) with poly I:C priming. In contrast to the BM-MSC paradigm, we did not detect significant changes in the expression of IL4, IL10 or TGFβ following TLR3 priming or of IL6 following TLR4 priming. Of note, when assessing the priming consequences of donor-matched ASCs and BM-MSCs (see supplementary Figure 3), we observed some differences in response to stimuli between cells derived from adipose tissue and bone marrow as well as a divergence in BM-MSC response to stimuli compared with that of the reported polarization paradigm [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ] at the gene expression level. It is likely that some of these differences may be attributable to differences in MSCs based on tissue source and donor-to-donor variability. For example, others have reported higher levels of IL-6 and TGF-β in ASCs relative to BM-MSCs [
      • Melief S.M.
      • Zwaginga J.J.
      • Fibbe W.E.
      • Roelofs H.
      Adipose tissue-derived multipotent stromal cells have a higher immunomodulatory capacity than their bone marrow-derived counterparts.
      ]. These baseline variations in gene expression may contribute to the differences detected in the response of MSCs to TLR agonists. Further, variations in expression of genes such as LPS-binding protein and TGFβ1 can also be observed across individual BM-MSC donor isolates, likely contributing to a variable response to external stimuli such as TLR engagement [
      • Levin S.
      • Pevsner-Fischer M.
      • Kagan S.
      • Lifshitz H.
      • Weinstock A.
      • Gataulin D.
      • Friedlander G.
      • Zipori D.
      Divergent levels of LBP and TGFβ1 in murine MSCs lead to heterogenic response to TLR and proinflammatory cytokine activation.
      ]. LPS-binding protein levels predict the ability of cells to secrete IL-6 in response to LPS.
      Table 2Summary of current knowledge regarding TLR3 and TLR4 stimulation of ASCs.
      Stimulant concentration and sourceTime of exposureGene expression signatureProtein expression signatureFunctional evaluationRef.
      Human
      30 µg/mL poly I:C or 10 µg/mL LPS (Sigma-Aldrich)18 hIL-1β, p35, EBI-3↑ IL-6, IL-8
      Changes that align with the authors’ differential gene expression observations.
      , CCL5
      Changes that align with the authors’ differential gene expression observations.
      , IL-1Ra, HLA I
      Changes that are similar to the authors’ observations for poly I:C-primed groups.
      — Suppression of T-cell allogeneic proliferation—

      PGE2 secretion in mixed leukocyte reaction + MSC co-cultures

      LPS:

      ↓ HGF secretion in mixed leukocyte reaction + MSC co-cultures
      • Raicevic G.
      • Najar M.
      • Stamatopoulos B.
      • De Bruyn C.
      • Meuleman N.
      • Bron D.
      • Toungouz M.
      • Lagneaux L.
      The source of human mesenchymal stromal cells influences their TLR profile as well as their functional properties.
      1 µg/mL poly I:C or 10 ng/mL LPS (Sigma-Aldrich)1 h↑ IL-8
      Changes that align with the authors’ differential gene expression observations.


      IL-6
      Changes that align with the authors’ differential gene expression observations.
      , CCL5, IDO
      Changes that are similar to the authors’ observations for LPS-primed groups.
      , IFN-γ
      Changes that align with the authors’ differential gene expression observations.
      , IL-1β
      Changes that align with the authors’ differential gene expression observations.
      , IL-1Ra, IL-4
      Changes that align with the authors’ differential gene expression observations.
      , IL-17,
      Changes that align with the authors’ differential gene expression observations.
      TGF-β
      Changes that align with the authors’ differential gene expression observations.
      • Jafari M.
      • Asghari A.
      • Delbandi A.A.
      • Jalessi M.
      • Jazayeri M.H.
      • Samarei R.
      • Tajik N.
      Priming TLR3 and TLR4 in human adipose- and olfactory mucosa-derived mesenchymal stromal cells and comparison of their cytokine secretions.
      25 µg/mL poly I:C or 10 µg/mL LPS from Escherichia coli O55:B5 (Sigma-Aldrich)24 h, constant exposure during differentiation assaysMCP-2
      Changes that are similar to the authors’ observations for poly I:C-primed groups.
      , GCP-2, IL-1β, MIP-3α
      Changes that align with the authors’ differential gene expression observations.
      , IL-6, TNF-α, IL-12, MCP-1
      Changes that are similar to the authors’ observations for poly I:C-primed groups.
      — Adipogenic differentiation

      LPS:

      ↑ Osteogenic differentiation
      • Cho H.Hwa
      • Bae Y.C.
      • Jung J.S.
      Role of Toll-like receptors on human adipose-derived stromal cells.
      0.1 µg/mL, 1 µg/mL or 10 µg/mL poly I:C or 0.1 µg/mL, 1 µg/mL or 10 µg/mL LPS72 h, constant exposure during differentiation assaysMnSOD↑ IL-6, IL-8—

      HLA II
      Changes that are similar to the authors’ observations for LPS-primed groups.
      , CD80
      Changes that align with the authors’ differential gene expression observations.
      , CD86
      Changes that align with the authors’ differential gene expression observations.
      Poly I:C:

      ↑ HLA I
      Changes that align with the authors’ differential gene expression observations.


      ↑ Osteogenic differentiation—

      Adipogenic differentiation—

      Proliferation—

      Suppression of PBMC proliferation

      Poly I:C:

      ↑ IDO activity at highest concentration only
      • Lombardo E.
      • DelaRosa O.
      • Mancheño-Corvo P.
      • Menta R.
      • Ramírez C.
      • Büscher D.
      Toll-like receptor-mediated signaling in human adipose-derived stem cells: implications for immunogenicity and immunosuppressive potential.
      0.5 ng/mL24 h↑ IL-6↑ IL-6↑ Conditioned medium-mediated liver regeneration
      • Lee S.C.
      • Jeong H.J.
      • Lee S.K.
      • Kim S.J.
      Lipopolysaccharide preconditioning of adipose-derived stem cells improves liver-regenerating activity of the secretome.
      0.01 µg/mL, 0.1 µg/mL or 1 µg/mL LPS (Sigma-Aldrich)1.5 h to 28 days, constant exposure during differentiation assays↑ NF-κB-p65 nuclear translocation

      ↑ Proliferation

      ↑ Osteogenic differentiation
      • Herzmann N.
      • Salamon A.
      • Fiedler T.
      • Peters K.
      Lipopolysaccharide induces proliferation and osteogenic differentiation of adipose-derived mesenchymal stromal cells in vitro via TLR4 activation.
      1:10, 1:50 or 1:100 cultivation medium of heat-inactivated E coli in DMEM to OD of 0.5 µg/mL, 0.01 µg/mL or 0.1 µg/mL LPS2 h to 35 days, constant exposure during differentiation assays↑ Proliferation of unstimulated and osteogenically stimulated ASCs—

      Proliferation of adipogenically stimulated ASCs

      ↑ Osteogenic differentiation
      • Fiedler T.
      • Salamon A.
      • Adam S.
      • Herzmann N.
      • Taubenheim J.
      • Peters K.
      Impact of bacteria and bacterial components on osteogenic and adipogenic differentiation of adipose-derived mesenchymal stem cells.
      30 µg/mL poly I:C

      or 10 µg/mL LPS

      (Sigma-Aldrich)
      Overnight↑ Osteogenic differentiation
      • Raicevic G.
      • Najar M.
      • Pieters K.
      • De Bruyn C.
      • Meuleman N.
      • Bron D.
      • Toungouz M.
      • Lagneaux L.
      Inflammation and Toll-like receptor ligation differentially affect the osteogenic potential of human mesenchymal stromal cells depending on their tissue origin.
      10–250 ng/mL E coli O26:B6 LPS (Sigma-Aldrich) or 1–25 µg/mL poly I:C (Sigma-Aldrich)3 h or 24 hHighest IDO
      Changes that align with the authors’ differential gene expression observations.
      expression in poly I:C-primed ASCs LPS priming at high dose induced IDO expression
      — TNF-α Highest IL-6 and IL-8
      Changes that align with the authors’ differential gene expression observations.
      in LPS-primed cells, although also increased in poly I:C-primed ASCs
      • Shoshina O.O.
      • Kozhin P.M.
      • Shadrin V.S.
      • Romashin D.D.
      • Rusanov A.L.
      • Luzgina N.G.
      Phenotypic Features of Mesenchymal Stem Cell Subpopulations Obtained under the Influence of Various Toll-Like Receptors Ligands.
      Murine
      5 µg/mL or 50 µg/mL poly I:C or 0.01 µg/mL or 0.1 µg/mL LPS (Sigma-Aldrich)6 h to 2 weeks, constant exposure during differentiation assays— IL-1β
      Changes that align with the authors’ differential gene expression observations.
      , TNF
      Changes that align with the authors’ differential gene expression observations.


      ↑ IL-6 LPS:

      ↑ IL-10, IL-12 (p40)
      ↑ Osteogenic differentiation

      ↑ STAT3 phosphorylation in osteogenically stimulated groups
      • Huh J.E.
      • Lee S.Y.
      IL-6 is produced by adipose-derived stromal cells and promotes osteogenesis.
      DMEM, Dulbecco's Modified Eagle's Medium; HGF, hepatocyte growth factor; IFN-γ, interferon gamma; OD, optical density; PGE2, prostaglandin E2.
      a Changes that align with the authors’ differential gene expression observations.
      b Changes that are similar to the authors’ observations for poly I:C-primed groups.
      c Changes that are similar to the authors’ observations for LPS-primed groups.
      In addition to changes in the expression of immunomodulatory cytokines and chemokines, we detected HLA gene upregulation in the gene expression assessment. Upregulation of these genes could have implications for increasing MSC immunogenicity. However, it has been proposed that rejection of MSCs is dependent on the balance of expression of both immunogenic and immunosuppressive factors [
      • Ankrum J.A.
      • Ong J.F.
      • Karp J.M.
      Mesenchymal stem cells: immune evasive, not immune privileged.
      ,
      • Schu S.
      • Nosov M.
      • O'Flynn L.
      • Shaw G.
      • Treacy O.
      • Barry F.
      • Murphy M.
      • O'Brien T.
      • Ritter T.
      Immunogenicity of allogeneic mesenchymal stem cells.
      ]. Thus, the overall effect of these priming strategies on ASC immunogenicity cannot be inferred by gene expression alone, but rather should include further assessment of specific phenotypes post-priming.
      Several groups have reported that stimulation of human ASCs with poly I:C or LPS may lead to similar cytokine expression profiles or gene expression changes [
      • Raicevic G.
      • Najar M.
      • Stamatopoulos B.
      • De Bruyn C.
      • Meuleman N.
      • Bron D.
      • Toungouz M.
      • Lagneaux L.
      The source of human mesenchymal stromal cells influences their TLR profile as well as their functional properties.
      ,
      • Cho H.Hwa
      • Bae Y.C.
      • Jung J.S.
      Role of Toll-like receptors on human adipose-derived stromal cells.
      ,
      • Lombardo E.
      • DelaRosa O.
      • Mancheño-Corvo P.
      • Menta R.
      • Ramírez C.
      • Büscher D.
      Toll-like receptor-mediated signaling in human adipose-derived stem cells: implications for immunogenicity and immunosuppressive potential.
      ,
      • Jafari M.
      • Asghari A.
      • Delbandi A.A.
      • Jalessi M.
      • Jazayeri M.H.
      • Samarei R.
      • Tajik N.
      Priming TLR3 and TLR4 in human adipose- and olfactory mucosa-derived mesenchymal stromal cells and comparison of their cytokine secretions.
      ]. However, some of our present findings contrast with these results. The similarities of other studies to our findings are illustrated in Table 2. Although our observations suggest that there is some overlap with other studies in the expression of cytokines and other molecules by ASCs, we observed some key differences in the effects stimulating ASCs between the two agonists examined (LPS and poly I:C). It is important to note that, in most cases, agonist concentrations used by other groups were significantly higher (up to 1000-fold) than those used in our protocols. Additionally, in the case of agonist exposure time, we utilized a 1-h window for ASC ligand treatment, whereas other groups stimulated the cells for up to 72 h. These differences in exposure levels may have contributed greatly to the differences observed.
      Waterman et al. [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ] emphasized in their seminal work that short-term, low-level exposure to agonists was necessary for achieving MSC polarization. This phenomenon in which MSC response to a stimulus may result in contrasting effects depending on the concentration of exposure has also been proposed by others based on the observation that low levels of stimulation may result in an immunostimulatory potential of MSCs but higher levels may result in enhanced immunosuppression (i.e., type I interferon) [
      • Shi Y.
      • Wang Y.
      • Li Q.
      • Liu K.
      • Hou J.
      • Shao C.
      Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases.
      ,
      • Shirjang S.
      • Mansoori B.
      • Solali S.
      • Hagh M.F.
      • Shamsasenjan K.
      Toll-like receptors as a key regulator of mesenchymal stem cell function: An up-to-date review.
      ]. Differences in the length of exposure to priming conditions have also been evaluated by other groups. With regard to TLR priming of MSCs, Kurte et al. evaluated the effects of short-term (1 h) and long-term (24 h or 48 h) exposure of murine BM-MSCs to LPS and reported that LPS induced pro- and anti-inflammatory MSC phenotypes upon short- and long-term exposure, respectively [
      • Kurte Mónica
      • Vega-Letter Ana María
      • Luz-Crawford Patricia
      • Djouad Farida
      • Noël Danièle
      • Khoury Maroun
      • et al.
      Time-dependent LPS exposure commands MSC immunoplasticity through TLR4 activation leading to opposite therapeutic outcome in EAE.
      ]. Furthermore, as the observed gene expression changes appear to be transient or to occur in phases, differences in the time of assessment may also contribute to the differences reported in the available literature. In summary, as expected, our study relates to and replicates several features of the study by Waterman et al. [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ] since the levels of agonist and time of exposure most closely resemble this seminal study.
      Based on the available literature, it is clear that the experimental conditions employed by Jafari et al. [
      • Jafari M.
      • Asghari A.
      • Delbandi A.A.
      • Jalessi M.
      • Jazayeri M.H.
      • Samarei R.
      • Tajik N.
      Priming TLR3 and TLR4 in human adipose- and olfactory mucosa-derived mesenchymal stromal cells and comparison of their cytokine secretions.
      ] and Shoshina et al.[
      • Shoshina O.O.
      • Kozhin P.M.
      • Shadrin V.S.
      • Romashin D.D.
      • Rusanov A.L.
      • Luzgina N.G.
      Phenotypic Features of Mesenchymal Stem Cell Subpopulations Obtained under the Influence of Various Toll-Like Receptors Ligands.
      ] most closely approximate those used in the present work. In the study by Jafari et al. [
      • Jafari M.
      • Asghari A.
      • Delbandi A.A.
      • Jalessi M.
      • Jazayeri M.H.
      • Samarei R.
      • Tajik N.
      Priming TLR3 and TLR4 in human adipose- and olfactory mucosa-derived mesenchymal stromal cells and comparison of their cytokine secretions.
      ], intriguingly, on examination of cytokine profiles of stimulated ASCs, no significant differences were detected in IDO expression upon poly I:C priming. This contrasts with our observations at the gene expression level. We have characterized in other experiments (see supplementary Figure 4) that the source and batch differences between poly I:C reagents can influence their ability to induce IDO and CXCL10 expression. These results are in line with observations by other groups indicating that various high- and low-molecular-weight forms of poly I:C can have distinct effects on stimulated cells [
      • Mian M.F.
      • Ahmed A.N.
      • Rad M.
      • Babaian A.
      • Bowdish D.
      • Ashkar A.A.
      Length of dsRNA (poly I:C) drives distinct innate immune responses, depending on the cell type.
      ,
      • Zhou Y.
      • Guo M.
      • Wang X.
      • Li J.
      • Wang Y.
      • Ye L.
      • Dai M.
      • Zhou L.
      • Persidsky Y.
      • Ho W.
      TLR3 activation efficiency by high or low molecular mass poly I:C.
      ]. This highlights the need for comprehensive characterization of priming agents and conditions intended for clinical application as well as strategies for MSC donor selection based on functional goals. Other culture conditions that may have implications for the observed responses include serum concentration and oxygen tension levels, as these have been reported to alter the immunomodulatory potential of MSCs and may also alter the expression levels of TLRs [
      • Cho H.H.
      • Shin K.K.
      • Kim Y.J.
      • Song J.S.
      • Kim J.M.
      • Bae Y.C.
      • Kim C.D.
      • Jung J.S.
      NF-kappaB activation stimulates osteogenic differentiation of mesenchymal stem cells derived from human adipose tissue by increasing TAZ expression.
      ,
      • Jiang C.M.
      • Liu J.
      • Zhao J.Y.
      • Xiao L.
      • An S.
      • Gou Y.C.
      • Quan H.X.
      • Cheng Q.
      • Zhang Y.L.
      • He W.
      • Wang Y.T.
      • Yu W.J.
      • Huang Y.F.
      • Yi Y.T.
      • Chen Y.
      • Wang J.
      Effects of hypoxia on the immunomodulatory properties of human gingiva-derived mesenchymal stem cells.
      ,
      • Vu B.T.
      • Le H.T.
      • Nguyen K.N.
      • Van Pham P.
      Hypoxia, Serum Starvation, and TNF-α Can Modify the Immunomodulation Potency of Human Adipose-Derived Stem Cells.
      ]. Similar to our observations, Shoshina et al. [
      • Shoshina O.O.
      • Kozhin P.M.
      • Shadrin V.S.
      • Romashin D.D.
      • Rusanov A.L.
      • Luzgina N.G.
      Phenotypic Features of Mesenchymal Stem Cell Subpopulations Obtained under the Influence of Various Toll-Like Receptors Ligands.
      ] reported higher induction of pro-inflammatory factors (i.e., IL8) by LPS stimulation. The same group also reported that upon stimulation at low concentrations of TLR ligands, poly I:C but not LPS induced upregulation of IDO at the messenger RNA level. Interestingly, at high concentrations, LPS was also shown to induce IDO expression, supporting the importance of the degree of stimulus on the resulting MSC phenotypes.
      Having demonstrated that ASCs undergo differential gene expression changes upon poly I:C and LPS priming, we sought to evaluate the phenotypic changes in these cells that relate to their functional capabilities. We chose functional assays that would be relevant to the potential use of ASC as cancer therapeutic tools, evaluating potential changes in ASC stemness, migration and direct and indirect modulation of prostate cancer cell abnormal growth or migration phenotypes.
      Several MSC applications intended for cancer therapeutics rely on the use of these cells in an undifferentiated state, likely as vehicles for the transportation of bioactive products or as modulators of immune response within the tumor microenvironment [
      • Hmadcha A.
      • Martin-Montalvo A.
      • Gauthier B.R.
      • Soria B.
      • Capilla-Gonzalez V.
      Therapeutic Potential of Mesenchymal Stem Cells for Cancer Therapy.
      ]. Thus, we sought to assess whether there were any observable changes in ASC stemness with the evaluated priming strategies. Several aspects can be evaluated to assess MSC stemness, including differentiation potential, marker expression and self-renewal capabilities. MSCs have been shown to express pluripotency markers when cultured in vitro (i.e., NANOG, OCT4, SOX2) [
      • Riekstina U.
      • Cakstina I.
      • Parfejevs V.
      • Hoogduijn M.
      • Jankovskis G.
      • Muiznieks I.
      • Muceniece R.
      • Ancans J.
      Embryonic stem cell marker expression pattern in human mesenchymal stem cells derived from bone marrow, adipose tissue, heart and dermis.
      ], and their expression is used as an indicator of MSC stemness [
      • Yoon D.S.
      • Kim Y.H.
      • Jung H.S.
      • Paik S.
      • Lee J.W.
      Importance of Sox2 in maintenance of cell proliferation and multipotency of mesenchymal stem cells in low-density culture.
      ,
      • Tsai C.C.
      • Su P.F.
      • Huang Y.F.
      • Yew T.L.
      • Hung S.C.
      Oct4 and Nanog directly regulate Dnmt1 to maintain self-renewal and undifferentiated state in mesenchymal stem cells.
      ,
      • Matic I.
      • Antunovic M.
      • Brkic S.
      • Josipovic P.
      • Mihalic K.C.
      • Karlak I.
      • Ivkovic A.
      • Marijanovic I.
      Expression of OCT-4 and SOX-2 in Bone Marrow-Derived Human Mesenchymal Stem Cells during Osteogenic Differentiation.
      ]. Our assessment of stemness markers demonstrated a transient decrease in expression of both NANOG and SOX2 with both priming strategies. Decreased expression of these markers has been reported by others upon lineage commitment and as MSC progress in passage number [
      • Yoon D.S.
      • Kim Y.H.
      • Jung H.S.
      • Paik S.
      • Lee J.W.
      Importance of Sox2 in maintenance of cell proliferation and multipotency of mesenchymal stem cells in low-density culture.
      ,
      • Matic I.
      • Antunovic M.
      • Brkic S.
      • Josipovic P.
      • Mihalic K.C.
      • Karlak I.
      • Ivkovic A.
      • Marijanovic I.
      Expression of OCT-4 and SOX-2 in Bone Marrow-Derived Human Mesenchymal Stem Cells during Osteogenic Differentiation.
      ]. This suggests that our described priming strategies result in a temporary change in ASC phenotype but without necessarily indicating a lineage commitment. Although other groups have not explored the permanence of observed effects on ASC stemness, similar to our findings, TLR priming can impact some stemness-related functional properties of MSCs. For example, poly I:C and LPS priming has been reported to promote changes in the proliferation and trilineage differentiation potential of ASCs [
      • Cho H.Hwa
      • Bae Y.C.
      • Jung J.S.
      Role of Toll-like receptors on human adipose-derived stromal cells.
      ,
      • Lombardo E.
      • DelaRosa O.
      • Mancheño-Corvo P.
      • Menta R.
      • Ramírez C.
      • Büscher D.
      Toll-like receptor-mediated signaling in human adipose-derived stem cells: implications for immunogenicity and immunosuppressive potential.
      ,
      • Herzmann N.
      • Salamon A.
      • Fiedler T.
      • Peters K.
      Lipopolysaccharide induces proliferation and osteogenic differentiation of adipose-derived mesenchymal stromal cells in vitro via TLR4 activation.
      ,
      • Ruhl T.
      • Kim B.S.
      • Beier J.P.
      Cannabidiol restores differentiation capacity of LPS exposed adipose tissue mesenchymal stromal cells.
      ]. Similarly, MSC1/MSC2 polarization has been shown to affect the trilineage differentiation potential of BM-MSCs [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ]. We further explored the effects of TLR priming on ASCs via differentiation assays and did not observe any significant differences across treatment groups. In addition, there were no notable differences in cell morphology in either primed groups or those stimulated with differentiation induction medium. Moreover, in contrast to the aforementioned studies, the differentiation potential was unaltered across treatment groups. In comparison, other groups assessed differentiation of MSCs under constant exposure to TLR ligands during their differentiation procedures, whereas in the present work, we remained consistent with the short-term, low-level exposure to these ligands.
      For ASCs to be used as delivery vehicles in cancer treatment, they must be able to home to tumor sites following infusion. Our assessment of ASC migration toward prostate cancer cells suggests that primed ASCs may continue to be attracted to prostate cancer cells in in vitro assays. However, poly I:C stimulation significantly decreased ASC migration, although it was not completely inhibited. By contrast, LPS stimulation did not significantly alter the migratory capabilities of ASCs under the experimental conditions. Others have reported that TLR stimulation alters MSC migration and invasion [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ,
      • Tomchuck S.L.
      • Zwezdaryk K.J.
      • Coffelt S.B.
      • Waterman R.S.
      • Danka E.S.
      • Scandurro A.B.
      Toll-like receptors on human mesenchymal stem cells drive their migration and immunomodulating responses.
      ]. Direct comparisons between these and our studies are limited by important differences in experimental design. Although other groups assessed MSC migration toward TLR agonists [
      • Tomchuck S.L.
      • Zwezdaryk K.J.
      • Coffelt S.B.
      • Waterman R.S.
      • Danka E.S.
      • Scandurro A.B.
      Toll-like receptors on human mesenchymal stem cells drive their migration and immunomodulating responses.
      ], specific chemotactic factors, or serum [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ], we used cancer cells and their CCM as attractants. The advantage of the CCM approach is that it may be more specific for assessing tumor tropism compared with other methodologies.
      The most commonly studied chemotactic axis in MSCs is the CXCR4/SDF-1 axis. Macrophage migration inhibitory factor has been reported by others to be the key director of MSC migration toward and infiltration in tumor cells [
      • Lourenco S.
      • Teixeira V.H.
      • Kalber T.
      • Jose R.J.
      • Floto R.A.
      • Janes S.M.
      Macrophage migration inhibitory factor-CXCR4 is the dominant chemotactic axis in human mesenchymal stem cell recruitment to tumors.
      ]. This factor has been shown to interact physically with CXCR2, CXCR4 and CD74, with CXCR4 being the dominant receptor used by macrophage migration inhibitory factor in the context of tumor homing. With the exception of CD74 upregulation at the 18-h time point with poly I:C priming, no significant differences were observed in the expression of these receptors in our treatments. Given that changes in the expression of CD74 were observed at the later time points and migration in our assay was assessed after 18 h, it is possible that these later phenotypic changes were not captured by the assay. Interestingly, although we did not detect any significant differences in the expression of CXCR4, it has been reported in the literature that TLR3 stimulation attenuates cell surface expression of CXCR4 in MSCs by inducing the internalization and degradation of this receptor [
      • Tomchuck S.L.
      • Henkle S.L.
      • Coffelt S.B.
      • Betancourt A.M.
      Toll-like receptor 3 and suppressor of cytokine signaling proteins regulate CXCR4 and CXCR7 expression in bone marrow-derived human multipotent stromal cells.
      ]. This phenomenon could potentially explain the slight decrease in migration observed for ASCs in our datasets upon TLR3 priming and may merit further exploration in the future.
      In the interest of evaluating the effect of TLR priming on ASC– prostate cancer cell interactions, we performed cell co-culture assays to assess the direct modulation of cancer progression via proliferation and migration assays. In these co-culture assays, we did not observe any significant differences in the treatment groups compared with the no ASC controls—in contrast to Waterman et al. [
      • Waterman R.S.
      • Henkle S.L.
      • Betancourt A.M.
      Mesenchymal stem cell 1 (MSC1)-based therapy attenuates tumor growth whereas MSC2-treatment promotes tumor growth and metastasis.
      ], who observed that unprimed MSCs promoted the growth and migration of cancer cells—and distinct and polarized effects were observed with regard to ovarian cancer cell growth and migration upon TLR priming. Thus, there may be potential differences in how MSCs interact with cancer cells from different tissue types.
      Two important aspects of the MSC polarization paradigm include (i) the distinct effects exerted by polarized subsets on T-cell activation in vitro [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ] and (ii) the modulation of tumor growth in vivo [
      • Waterman R.S.
      • Henkle S.L.
      • Betancourt A.M.
      Mesenchymal stem cell 1 (MSC1)-based therapy attenuates tumor growth whereas MSC2-treatment promotes tumor growth and metastasis.
      ]; namely, when assessing alloreactive T-cell proliferation via allogeneic mixed lymphocyte and MSC reactions, the immunosuppressive effect of MSCs was reversed by LPS-stimulated BM-MSCs (MSC1), whereas poly I:C-stimulated BM-MSCs (MSC2) suppressed T lymphocyte activation [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ]. Additionally, in the context of an immunocompetent mouse model of ovarian cancer, treatment with MSC1 reduced tumor growth relative to unprimed MSCs, whereas MSC2 treatment enhanced tumor growth [
      • Waterman R.S.
      • Henkle S.L.
      • Betancourt A.M.
      Mesenchymal stem cell 1 (MSC1)-based therapy attenuates tumor growth whereas MSC2-treatment promotes tumor growth and metastasis.
      ]. Few other reports apart from the present work have assessed the effects of TLR ligation on ASC immunomodulation. No significant effects of TLR stimulation with regard to ASC modulation of PBMC proliferation have been reported under different TLR priming parameters [
      • Raicevic G.
      • Najar M.
      • Stamatopoulos B.
      • De Bruyn C.
      • Meuleman N.
      • Bron D.
      • Toungouz M.
      • Lagneaux L.
      The source of human mesenchymal stromal cells influences their TLR profile as well as their functional properties.
      ,
      • Lombardo E.
      • DelaRosa O.
      • Mancheño-Corvo P.
      • Menta R.
      • Ramírez C.
      • Büscher D.
      Toll-like receptor-mediated signaling in human adipose-derived stem cells: implications for immunogenicity and immunosuppressive potential.
      ].
      Although MSCs are traditionally assessed for their immunomodulatory potential in the context of mixed leukocyte reactions, given that the crosstalk between cancer cells, MSCs and immune cells may affect the activity of different cell populations (i.e., MSCs may shift their functional phenotype when exposed to the tumor microenvironment [
      • Li W.
      • Zhang X.
      • Wu F.
      • Zhou Y.
      • Bao Z.
      • Li H.
      • Zheng P.
      • Zhao S.
      Gastric cancer-derived mesenchymal stromal cells trigger M2 macrophage polarization that promotes metastasis and EMT in gastric cancer.
      ]), we investigated the potential effects of TLR priming of ASCs on the immune response against cancer cells. For this purpose, we used an ASC–prostate cancer cell–PBMC co-culture immune cell killing assay. In this assay, co-culture with LPS-stimulated ASCs resulted in a significant increase in cancer cell killing in the presence of IL-2 and anti-CD3. By contrast, no significant differences in cancer cell killing were detected in the presence of unprimed or poly I:C-primed ASCs. IL-2 is an important modulator of various immune populations, playing key roles in the development, proliferation and activation of several immune subsets, including various T-cell subsets and NK cells [
      • Bendickova K.
      • Fric J.
      Roles of IL-2 in bridging adaptive and innate immunity, and as a tool for cellular immunotherapy.
      ]. The role of IL-2 in T-cell proliferation and activation is highly dependent on the presence of co-stimulatory molecules. The processes of NK expansion, maturation and cytotoxicity are also strongly dependent on IL-2. The induction of immune cell killing observed in our study upon IL-2 stimulation might be partially mediated by NK cell cytotoxicity. Other groups have explored the effects of MSCs on NK cell activation, reporting roles in the stimulation or inhibition of these cells in a context-dependent manner via soluble factors as well as cell–cell interactions [
      • Spaggiari G.M.
      • Capobianco A.
      • Becchetti S.
      • Mingari M.C.
      • Moretta L.
      Mesenchymal stem cell-natural killer cell interactions: evidence that activated NK cells are capable of killing MSCs, whereas MSCs can inhibit IL-2-induced NK-cell proliferation.
      ,
      • Cui R.
      • Rekasi H.
      • Hepner-Schefczyk M.
      • Fessmann K.
      • Petri R.M.
      • Bruderek K.
      • Brandau S.
      • Jäger M.
      • Flohé S.B.
      Human mesenchymal stromal/stem cells acquire immunostimulatory capacity upon cross-talk with natural killer cells and might improve the NK cell function of immunocompromised patients.
      ,
      • Spaggiari G.M.
      • Capobianco A.
      • Abdelrazik H.
      • Becchetti F.
      • Mingari M.C.
      • Moretta L.
      Mesenchymal stem cells inhibit natural killer-cell proliferation, cytotoxicity, and cytokine production: role of indoleamine 2,3-dioxygenase and prostaglandin E2.
      ,
      • Najar M.
      • Fayyad-Kazan M.
      • Meuleman N.
      • Bron D.
      • Fayyad-Kazan H.
      • Lagneaux L.
      Mesenchymal stromal cells of the bone marrow and natural killer cells: cell interactions and cross modulation.
      ]. Although these studies do not account for the potential influence of the crosstalk between tumor cells, MSCs, and immune cells, some suggest that MSCs have the potential to enhance the cytolytic activity of NK cells by modulating cytokine secretion and enhancing degranulation activity [
      • Cui R.
      • Rekasi H.
      • Hepner-Schefczyk M.
      • Fessmann K.
      • Petri R.M.
      • Bruderek K.
      • Brandau S.
      • Jäger M.
      • Flohé S.B.
      Human mesenchymal stromal/stem cells acquire immunostimulatory capacity upon cross-talk with natural killer cells and might improve the NK cell function of immunocompromised patients.
      ,
      • Najar M.
      • Fayyad-Kazan M.
      • Meuleman N.
      • Bron D.
      • Fayyad-Kazan H.
      • Lagneaux L.
      Mesenchymal stromal cells of the bone marrow and natural killer cells: cell interactions and cross modulation.
      ]. Since a combination of IL-2 and anti-CD3 is typically utilized to induce activation of T-cell subsets within PBMCs, T-cell-mediated killing is likely one of the primary contributors to the reductions in PC3 cancer cells demonstrated in the present work.
      In line with the pro-inflammatory phenotype detected at the gene expression level, LPS-primed ASCs significantly improved prostate cancer cell killing in some treatment groups. Unfortunately, our gene expression array did not yield an obvious candidate for mediating this immune activating effect. The majority of the genes upregulated upon LPS priming encode for proteins with roles in chemoattraction. A limitation of the gene expression assessment is that although it encompassed a wide array of genes related to human immunology, information remains incomplete on other important potential mediators; however, this can be addressed in future studies using, for example, RNA sequencing evaluations. Further, it is likely that any effects observed in immunomodulation are a result of the combined action of multiple factors as opposed to a single mediator.
      Work by others suggests that MSCs are not inherently immunosuppressive, but rather become immunosuppressive as a response to inflammatory signals such as T-cell cytokines [
      • Shi Y.
      • Wang Y.
      • Li Q.
      • Liu K.
      • Hou J.
      • Shao C.
      Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases.
      ,
      Mesenchymal Stem Cell-Mediated Immunosuppression Occurs via Concerted Action of Chemokines and Nitric Oxide.
      ,
      • Ren G.
      • Su J.
      • Zhang L.
      • Zhao X.
      • Ling W.
      • L'huillie A.
      • Zhang J.
      • Lu Y.
      • Roberts A.I.
      • Ji W.
      • Zhang H.
      • Rabson A.B.
      • Shi Y.
      Species variation in the mechanisms of mesenchymal stem cell-mediated immunosuppression.
      ]. To a certain extent, a temporary functional commitment—supported by the initial downregulation of stemness markers observed in our assays—could result in reduced responsiveness of the cells to further stimuli, preventing them from acquiring an immunosuppressive program upon interaction with activated immune cells. This could partially explain the differences observed across ASC treatment groups in these assays.
      Unprimed and poly I:C-primed ASCs did not exhibit significant differences in this assay compared with controls lacking ASCs. MSC immunosuppression is a result of the combined action of cytokines, cell surface molecules and chemokines [
      • Liu S.
      • Liu F.
      • Zhou Y.
      • Jin B.
      • Sun Q.
      • Guo S.
      Immunosuppressive Property of MSCs Mediated by Cell Surface Receptors.
      ,
      • Ren G.
      • Zhang L.
      • Zhao X.
      • Xu G.
      • Zhang Y.
      • Roberts A.I.
      • Chunhua Zhao R.
      • Shi Y.
      Mesenchymal Stem Cell-Mediated Immunosuppression Occurs via Concerted Action of Chemokines and Nitric Oxide.
      ,
      • Ren G.
      • Zhao X.
      • Zhang L.
      • Zhang J.
      • L'Huillier A.
      • Ling W.
      • Roberts A.I.
      • Le A.D.
      • Shi S.
      • Shao C.
      • Shi Y.
      Inflammatory cytokine-induced intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 in mesenchymal stem cells are critical for immunosuppression.
      ]. Ren et al. [
      • Ren G.
      • Zhang L.
      • Zhao X.
      • Xu G.
      • Zhang Y.
      • Roberts A.I.
      • Chunhua Zhao R.
      • Shi Y.
      Mesenchymal Stem Cell-Mediated Immunosuppression Occurs via Concerted Action of Chemokines and Nitric Oxide.
      ] reported that pro-inflammatory cytokines induce the immunosuppressive potential of murine BM-MSCs through the combined action with secreted factors such as nitric oxide. Adhesion molecules such as intercellular adhesion molecule 1 and vascular cell adhesion molecule 1 have also been identified as important for immunoregulation by murine BM-MSCs [
      • Ren G.
      • Zhao X.
      • Zhang L.
      • Zhang J.
      • L'Huillier A.
      • Ling W.
      • Roberts A.I.
      • Le A.D.
      • Shi S.
      • Shao C.
      • Shi Y.
      Inflammatory cytokine-induced intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 in mesenchymal stem cells are critical for immunosuppression.
      ]. Similarly, immunosuppression mediated by human BM-MSCs is induced by a combination of inflammatory chemokines and soluble factors, although the primary mediator (IDO) differs from that of murine BM-MSCs (nitric oxide) [
      • Ren G.
      • Su J.
      • Zhang L.
      • Zhao X.
      • Ling W.
      • L'huillie A.
      • Zhang J.
      • Lu Y.
      • Roberts A.I.
      • Ji W.
      • Zhang H.
      • Rabson A.B.
      • Shi Y.
      Species variation in the mechanisms of mesenchymal stem cell-mediated immunosuppression.
      ]. Although our gene expression assessment resulted in the identification of upregulation of some immunosuppressive factors (i.e., IDO) upon poly I:C stimulation of ASCs, it is possible that this immunosuppressive program is somewhat incomplete or requires multiple steps for its complete activation, preventing the immunosuppressive effects to be captured in the assays. Alternatively, other aspects of the experimental design, such as cell ratios and signal contributions from cancer cells, may have played a role in the MSC effects detected in this study, as MSC immunomodulation is traditionally assessed in co-cultures with PBMCs at higher MSC:PBMC ratios than those used in the present work.
      The findings discussed in this study may help inform therapeutic development strategies that aim to utilize human ASCs. In addition, our results highlight the importance of taking into consideration the disease context in which these cells are to be used. Further, priming strategies such as those described earlier may better inform strategies that rely on the use of other MSC products, such as extracellular vesicles, as these approaches may also impact the yield, function, and phenotype of these products [
      • Andrews S.
      • Maughon T.
      • Marklein R.
      • Stice S.
      Priming of MSCs with inflammation-relevant signals affects extracellular vesicle biogenesis, surface markers, and modulation of T cell subsets.
      ].

      Conclusions

      Collectively, our data suggest that priming of human ASCs via LPS or poly I:C stimulation results in distinct effects on their phenotypic and functional properties. Namely, distinct gene expression changes are induced by each of these ligands (LPS, poly I:C), resembling in part the polarization phenotypes reported to occur in human BM-MSCs [
      • Waterman R.S.
      • Tomchuck S.L.
      • Henkle S.L.
      • Betancourt A.M.
      A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
      ]. Our priming strategies also led to changes in the functional properties of these cells, affecting their ability to migrate and modulate immune-mediated responses to prostate cancer cells in vitro. Although these assessments suggested that LPS priming of human ASCs may induce an anti-tumorigenic phenotype, our chosen assays had some limitations, in that they could not incorporate the impacts of other processes important to tumor progression and immunomodulation, such as cell recruitment, angiogenesis, and interactions with other components of the tumor stroma. Thus, further exploration of the role of TLR-primed ASCs in modulation of the tumor microenvironment will be necessary in future studies.

      Funding

      This study was supported by the Purdue University Department of Basic Medical Sciences , Purdue Research Foundation ( 60000025) , Purdue Doctoral Fellowship ( CMR ) and National Institutes of Health (MLF; R21CA153165 ), and Purdue Center for Cancer Research NIH grant P30 CA023168.

      Declaration of Competing Interest

      The authors have no commercial, proprietary or financial interest in the products or companies described in this article.

      Author Contributions

      Conception and design of the study: CMR and MLF. Acquisition of data: CMR. Analysis and interpretation of data: CMR. Drafting or revising the manuscript: CMR and MLF. Both authors have approved the final article.

      Acknowledgments

      The authors acknowledge support from the Purdue University Department of Basic Medical Sciences , Purdue Imaging Facility and Research Technology Support Facility Genomics Core at Michigan State University. The authors thank Dr Jeffrey Gimble for his feedback on the project and manuscript, Shreya Kumar for her labeling of the Nuclight Red PC3 cells and contributions to the development of the co-culture immune cell killing assay and Dr Joseph Shearer for his mentoring and suggested ASC cell culture modifications.

      Appendix. Supplementary materials

      References

        • Shi Y.
        • Wang Y.
        • Li Q.
        • Liu K.
        • Hou J.
        • Shao C.
        Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases.
        Nat Rev Nephrol. 2018; 14: 493-507
        • Dominici M.
        • Blanc K.Le
        • Mueller I.
        • Slaper-Cortenbach I.
        • Marini F.
        • Krause D.
        • Deans R.
        • Keating A.
        • Prockop D.
        • Horwitz E.
        Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement.
        Cytotherapy. 2006; 8: 315-317
        • Kim N.
        • Cho S.G.
        Clinical applications of mesenchymal stem cells.
        Korean J Intern Med. 2013; 28: 387-402
        • Lalu M.M.
        • Mazzarello S.
        • Zlepnig J.
        • Dong Y.Y.R.
        • Montroy J.
        • McIntyre L.
        • Devereaux P.J.
        • Stewart D.J.
        • Mazer C.David
        • Barron C.C.
        • McIsaac D.I.
        • Fergusson D.A.
        Safety and Efficacy of Adult Stem Cell Therapy for Acute Myocardial Infarction and Ischemic Heart Failure (SafeCell Heart): A Systematic Review and Meta-Analysis.
        Stem Cells Transl Med. 2018; 7: 857-866
        • Lalu M.M.
        • McIntyre L.
        • Pugliese C.
        • Fergusson D.
        • Winston B.W.
        • Marshall J.C.
        • Granton J.
        • Stewart D.J.
        • Group C.C.C.T.
        Safety of cell therapy with mesenchymal stromal cells (SafeCell): a systematic review and meta-analysis of clinical trials.
        PLoS One. 2012; 7: e47559
        • Hmadcha A.
        • Martin-Montalvo A.
        • Gauthier B.R.
        • Soria B.
        • Capilla-Gonzalez V.
        Therapeutic Potential of Mesenchymal Stem Cells for Cancer Therapy.
        Front Bioeng Biotechnol. 2020; 8: 43
      1. Mesenchymal Stem Cell-Mediated Immunosuppression Occurs via Concerted Action of Chemokines and Nitric Oxide.
        Cell Stem Cell. 2008; 2: 141-150
        • Waterman R.S.
        • Tomchuck S.L.
        • Henkle S.L.
        • Betancourt A.M.
        A new mesenchymal stem cell (MSC) paradigm: polarization into a pro-inflammatory MSC1 or an Immunosuppressive MSC2 phenotype.
        PLoS One. 2010; 5: e10088
        • Li W.
        • Ren G.
        • Huang Y.
        • Su J.
        • Han Y.
        • Li J.
        • Chen X.
        • Cao K.
        • Chen Q.
        • Shou P.
        • Zhang L.
        • Yuan Z.R.
        • Roberts A.I.
        • Shi S.
        • Le A.D.
        • Shi Y.
        Mesenchymal stem cells: a double-edged sword in regulating immune responses.
        Cell Death Differ. 2012; 19: 1505-1513
        • Chen X.
        • Zhang Z.Y.
        • Zhou H.
        • Zhou G.W.
        Characterization of mesenchymal stem cells under the stimulation of Toll-like receptor agonists.
        Dev Growth Differ. 2014; 56: 233-244
        • DelaRosa O.
        • Lombardo E.
        Modulation of adult mesenchymal stem cells activity by toll-like receptors: implications on therapeutic potential.
        Mediators Inflamm. 2010; 2010865601
        • Najar M.
        • Krayem M.
        • Meuleman N.
        • Bron D.
        • Lagneaux L.
        Mesenchymal Stromal Cells and Toll-Like Receptor Priming: A Critical Review.
        Immune Netw. 2017; 17: 89-102
        • Pevsner-Fischer M.
        • Morad V.
        • Cohen-Sfady M.
        • Rousso-Noori L.
        • Zanin-Zhorov A.
        • Cohen S.
        • Cohen I.R.
        • Zipori D.
        Toll-like receptors and their ligands control mesenchymal stem cell functions.
        Blood. 2007; 109: 1422-1432
        • Tomchuck S.L.
        • Zwezdaryk K.J.
        • Coffelt S.B.
        • Waterman R.S.
        • Danka E.S.
        • Scandurro A.B.
        Toll-like receptors on human mesenchymal stem cells drive their migration and immunomodulating responses.
        Stem Cells. 2008; 26: 99-107
        • Sangiorgi B.
        • Panepucci R.A.
        Modulation of Immunoregulatory Properties of Mesenchymal Stromal Cells by Toll-Like Receptors: Potential Applications on GVHD.
        Stem Cells Int. 2016; 20169434250
        • Vega-Letter A.M.
        • Kurte M.
        • Fernández-O'Ryan C.
        • Gauthier-Abeliuk M.
        • Fuenzalida P.
        • Moya-Uribe I.
        • Altamirano C.
        • Figueroa F.
        • Irarrázabal C.
        • Carrión F.
        Differential TLR activation of murine mesenchymal stem cells generates distinct immunomodulatory effects in EAE.
        Stem Cell Res Ther. 2016; 7: 150
        • Waterman R.S.
        • Henkle S.L.
        • Betancourt A.M.
        Mesenchymal stem cell 1 (MSC1)-based therapy attenuates tumor growth whereas MSC2-treatment promotes tumor growth and metastasis.
        PLoS One. 2012; 7: e45590
        • Raicevic G.
        • Najar M.
        • Stamatopoulos B.
        • De Bruyn C.
        • Meuleman N.
        • Bron D.
        • Toungouz M.
        • Lagneaux L.
        The source of human mesenchymal stromal cells influences their TLR profile as well as their functional properties.
        Cell Immunol. 2011; 270: 207-216
        • El Atat O.
        • Antonios D.
        • Hilal G.
        • Hokayem N.
        • Abou-Ghoch J.
        • Hashim H.
        • Serhal R.
        • Hebbo C.
        • Moussa M.
        • Alaaeddine N.
        An Evaluation of the Stemness, Paracrine, and Tumorigenic Characteristics of Highly Expanded, Minimally Passaged Adipose-Derived Stem Cells.
        PLoS One. 2016; 11e0162332
        • Kern S.
        • Eichler H.
        • Stoeve J.
        • Klüter H.
        • Bieback K.
        Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue.
        Stem Cells. 2006; 24: 1294-1301
        • Shearer J.J.
        • Wold E.A.
        • Umbaugh C.S.
        • Lichti C.F.
        • Nilsson C.L.
        • Figueiredo M.L.
        Inorganic Arsenic-Related Changes in the Stromal Tumor Microenvironment in a Prostate Cancer Cell-Conditioned Media Model.
        Environ Health Perspect. 2016; 124: 1009-1015
        • Metsalu T.
        • Vilo J.
        ClustVis: a web tool for visualizing clustering of multivariate data using principal component analysis and heatmap.
        Nucleic Acids Res. 2015; 43: W566-W570
        • Zhou Y.
        • Zhou B.
        • Pache L.
        • Chang M.
        • Khodabakhshi A.H.
        • Tanaseichuk O.
        • Benner C.
        • Chanda S.K.
        Metascape provides a biologist-oriented resource for the analysis of systems-level datasets.
        Nat Commun. 2019; 10: 1523
        • Betancourt A.M.
        • Waterman R.S.
        The Role of Mesenchymal Stem Cells in the Tumor Microenvironment, Tumor Microenvironment and Myelomonocytic Cells.
        IntechOpen. 2012; : 255-286
        • Kadle R.L.
        • Abdou S.A.
        • Villarreal-Ponce A.P.
        • Soares M.A.
        • Sultan D.L.
        • David J.A.
        • Massie J.
        • Rifkin W.J.
        • Rabbani P.
        • Ceradini D.J.
        Microenvironmental cues enhance mesenchymal stem cell-mediated immunomodulation and regulatory T-cell expansion.
        PLoS One. 2018; 13e0193178
        • Rowland A.L.
        • Xu J.J.
        • Joswig A.J.
        • Gregory C.A.
        • Antczak D.F.
        • Cummings K.J.
        • Watts A.E.
        In vitro MSC function is related to clinical reaction in vivo.
        Stem Cell Res Ther. 2018; 9: 295
        • Yoon D.S.
        • Kim Y.H.
        • Jung H.S.
        • Paik S.
        • Lee J.W.
        Importance of Sox2 in maintenance of cell proliferation and multipotency of mesenchymal stem cells in low-density culture.
        Cell Prolif. 2011; 44: 428-440
        • Kolf C.M.
        • Cho E.
        • Tuan R.S.
        Mesenchymal stromal cells. Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation.
        Arthritis Res Ther. 2007; 9: 204
        • Tsai C.C.
        • Su P.F.
        • Huang Y.F.
        • Yew T.L.
        • Hung S.C.
        Oct4 and Nanog directly regulate Dnmt1 to maintain self-renewal and undifferentiated state in mesenchymal stem cells.
        Mol Cell. 2012; 47: 169-182
        • Cheng S.
        • Nethi S.K.
        • Rathi S.
        • Layek B.
        • Prabha S.
        Engineered Mesenchymal Stem Cells for Targeting Solid Tumors: Therapeutic Potential beyond Regenerative Therapy.
        J Pharmacol Exp Ther. 2019; 370: 231-241
        • Nowakowski A.
        • Drela K.
        • Rozycka J.
        • Janowski M.
        • Lukomska B.
        Engineered Mesenchymal Stem Cells as an Anti-Cancer Trojan Horse.
        Stem Cells Dev. 2016; 25: 1513-1531
        • Rivera-Cruz C.M.
        • Shearer J.J.
        • Figueiredo Neto M.
        • Figueiredo M.L.
        The Immunomodulatory Effects of Mesenchymal Stem Cell Polarization within the Tumor Microenvironment Niche.
        Stem Cells Int. 2017; 20174015039
        • Abbas A.K.
        • Trotta E.
        • Simeonov D.R
        • Marson A.
        • Bluestone J.A.
        Revisiting IL-2: Biology and therapeutic prospects.
        Sci Immunol. 2018; 3: 1-8
        • Berebichez-Fridman R.
        • Montero-Olvera P.R.
        Sources and Clinical Applications of Mesenchymal Stem Cells: State-of-the-art review.
        Sultan Qaboos Univ Med J. 2018; 18: e264-e277
        • Raicevic G.
        • Najar M.
        • Pieters K.
        • De Bruyn C.
        • Meuleman N.
        • Bron D.
        • Toungouz M.
        • Lagneaux L.
        Inflammation and Toll-like receptor ligation differentially affect the osteogenic potential of human mesenchymal stromal cells depending on their tissue origin.
        Tissue Eng Part A. 2012; 18: 1410-1418
        • Cho H.Hwa
        • Bae Y.C.
        • Jung J.S.
        Role of Toll-like receptors on human adipose-derived stromal cells.
        Stem Cells. 2006; 24: 2744-2752
        • Lombardo E.
        • DelaRosa O.
        • Mancheño-Corvo P.
        • Menta R.
        • Ramírez C.
        • Büscher D.
        Toll-like receptor-mediated signaling in human adipose-derived stem cells: implications for immunogenicity and immunosuppressive potential.
        Tissue Eng Part A. 2009; 15: 1579-1589
        • Jafari M.
        • Asghari A.
        • Delbandi A.A.
        • Jalessi M.
        • Jazayeri M.H.
        • Samarei R.
        • Tajik N.
        Priming TLR3 and TLR4 in human adipose- and olfactory mucosa-derived mesenchymal stromal cells and comparison of their cytokine secretions.
        Cytotechnology. 2020; 72: 57-68
        • Herzmann N.
        • Salamon A.
        • Fiedler T.
        • Peters K.
        Lipopolysaccharide induces proliferation and osteogenic differentiation of adipose-derived mesenchymal stromal cells in vitro via TLR4 activation.
        Exp Cell Res. 2017; 350: 115-122
        • Lee S.C.
        • Jeong H.J.
        • Lee S.K.
        • Kim S.J.
        Lipopolysaccharide preconditioning of adipose-derived stem cells improves liver-regenerating activity of the secretome.
        Stem Cell Res Ther. 2015; 6: 75
        • Fiedler T.
        • Salamon A.
        • Adam S.
        • Herzmann N.
        • Taubenheim J.
        • Peters K.
        Impact of bacteria and bacterial components on osteogenic and adipogenic differentiation of adipose-derived mesenchymal stem cells.
        Exp Cell Res. 2013; 319: 2883-2892
        • Huh J.E.
        • Lee S.Y.
        IL-6 is produced by adipose-derived stromal cells and promotes osteogenesis.
        Biochim Biophys Acta. 2013; 1833: 2608-2616
        • Melief S.M.
        • Zwaginga J.J.
        • Fibbe W.E.
        • Roelofs H.
        Adipose tissue-derived multipotent stromal cells have a higher immunomodulatory capacity than their bone marrow-derived counterparts.
        Stem Cells Transl Med. 2013; 2: 455-463
        • Levin S.
        • Pevsner-Fischer M.
        • Kagan S.
        • Lifshitz H.
        • Weinstock A.
        • Gataulin D.
        • Friedlander G.
        • Zipori D.
        Divergent levels of LBP and TGFβ1 in murine MSCs lead to heterogenic response to TLR and proinflammatory cytokine activation.
        Stem Cell Rev Rep. 2014; 10: 376-388
        • Ankrum J.A.
        • Ong J.F.
        • Karp J.M.
        Mesenchymal stem cells: immune evasive, not immune privileged.
        Nat Biotechnol. 2014; 32: 252-260
        • Schu S.
        • Nosov M.
        • O'Flynn L.
        • Shaw G.
        • Treacy O.
        • Barry F.
        • Murphy M.
        • O'Brien T.
        • Ritter T.
        Immunogenicity of allogeneic mesenchymal stem cells.
        J Cell Mol Med. 2012; 16: 2094-2103
        • Shirjang S.
        • Mansoori B.
        • Solali S.
        • Hagh M.F.
        • Shamsasenjan K.
        Toll-like receptors as a key regulator of mesenchymal stem cell function: An up-to-date review.
        Cell Immunol. 2017; 315: 1-10
        • Shoshina O.O.
        • Kozhin P.M.
        • Shadrin V.S.
        • Romashin D.D.
        • Rusanov A.L.
        • Luzgina N.G.
        Phenotypic Features of Mesenchymal Stem Cell Subpopulations Obtained under the Influence of Various Toll-Like Receptors Ligands.
        Bull Exp Biol Med. 2021; 170: 555-559
        • Mian M.F.
        • Ahmed A.N.
        • Rad M.
        • Babaian A.
        • Bowdish D.
        • Ashkar A.A.
        Length of dsRNA (poly I:C) drives distinct innate immune responses, depending on the cell type.
        J Leukoc Biol. 2013; 94: 1025-1036
        • Zhou Y.
        • Guo M.
        • Wang X.
        • Li J.
        • Wang Y.
        • Ye L.
        • Dai M.
        • Zhou L.
        • Persidsky Y.
        • Ho W.
        TLR3 activation efficiency by high or low molecular mass poly I:C.
        Innate Immun. 2013; 19: 184-192
        • Cho H.H.
        • Shin K.K.
        • Kim Y.J.
        • Song J.S.
        • Kim J.M.
        • Bae Y.C.
        • Kim C.D.
        • Jung J.S.
        NF-kappaB activation stimulates osteogenic differentiation of mesenchymal stem cells derived from human adipose tissue by increasing TAZ expression.
        J Cell Physiol. 2010; 223: 168-177
        • Jiang C.M.
        • Liu J.
        • Zhao J.Y.
        • Xiao L.
        • An S.
        • Gou Y.C.
        • Quan H.X.
        • Cheng Q.
        • Zhang Y.L.
        • He W.
        • Wang Y.T.
        • Yu W.J.
        • Huang Y.F.
        • Yi Y.T.
        • Chen Y.
        • Wang J.
        Effects of hypoxia on the immunomodulatory properties of human gingiva-derived mesenchymal stem cells.
        J Dent Res. 2015; 94: 69-77
        • Vu B.T.
        • Le H.T.
        • Nguyen K.N.
        • Van Pham P.
        Hypoxia, Serum Starvation, and TNF-α Can Modify the Immunomodulation Potency of Human Adipose-Derived Stem Cells.
        Adv Exp Med Biol. 2021; : 1-16https://doi.org/10.1007/5584_2021_672
        • Riekstina U.
        • Cakstina I.
        • Parfejevs V.
        • Hoogduijn M.
        • Jankovskis G.
        • Muiznieks I.
        • Muceniece R.
        • Ancans J.
        Embryonic stem cell marker expression pattern in human mesenchymal stem cells derived from bone marrow, adipose tissue, heart and dermis.
        Stem Cell Rev Rep. 2009; 5: 378-386
        • Matic I.
        • Antunovic M.
        • Brkic S.
        • Josipovic P.
        • Mihalic K.C.
        • Karlak I.
        • Ivkovic A.
        • Marijanovic I.
        Expression of OCT-4 and SOX-2 in Bone Marrow-Derived Human Mesenchymal Stem Cells during Osteogenic Differentiation.
        Open Access Maced J Med Sci. 2016; 4: 9-16
        • Ruhl T.
        • Kim B.S.
        • Beier J.P.
        Cannabidiol restores differentiation capacity of LPS exposed adipose tissue mesenchymal stromal cells.
        Exp Cell Res. 2018; 370: 653-662
        • Lourenco S.
        • Teixeira V.H.
        • Kalber T.
        • Jose R.J.
        • Floto R.A.
        • Janes S.M.
        Macrophage migration inhibitory factor-CXCR4 is the dominant chemotactic axis in human mesenchymal stem cell recruitment to tumors.
        J Immunol. 2015; 194: 3463-3474
        • Tomchuck S.L.
        • Henkle S.L.
        • Coffelt S.B.
        • Betancourt A.M.
        Toll-like receptor 3 and suppressor of cytokine signaling proteins regulate CXCR4 and CXCR7 expression in bone marrow-derived human multipotent stromal cells.
        PLoS One. 2012; 7: e39592
        • Li W.
        • Zhang X.
        • Wu F.
        • Zhou Y.
        • Bao Z.
        • Li H.
        • Zheng P.
        • Zhao S.
        Gastric cancer-derived mesenchymal stromal cells trigger M2 macrophage polarization that promotes metastasis and EMT in gastric cancer.
        Cell Death Dis. 2019; 10: 918
        • Bendickova K.
        • Fric J.
        Roles of IL-2 in bridging adaptive and innate immunity, and as a tool for cellular immunotherapy.
        J Leukoc Biol. 2020; 108: 427-437
        • Spaggiari G.M.
        • Capobianco A.
        • Becchetti S.
        • Mingari M.C.
        • Moretta L.
        Mesenchymal stem cell-natural killer cell interactions: evidence that activated NK cells are capable of killing MSCs, whereas MSCs can inhibit IL-2-induced NK-cell proliferation.
        Blood. 2006; 107: 1484-1490
        • Cui R.
        • Rekasi H.
        • Hepner-Schefczyk M.
        • Fessmann K.
        • Petri R.M.
        • Bruderek K.
        • Brandau S.
        • Jäger M.
        • Flohé S.B.
        Human mesenchymal stromal/stem cells acquire immunostimulatory capacity upon cross-talk with natural killer cells and might improve the NK cell function of immunocompromised patients.
        Stem Cell Res Ther. 2016; 7: 88
        • Spaggiari G.M.
        • Capobianco A.
        • Abdelrazik H.
        • Becchetti F.
        • Mingari M.C.
        • Moretta L.
        Mesenchymal stem cells inhibit natural killer-cell proliferation, cytotoxicity, and cytokine production: role of indoleamine 2,3-dioxygenase and prostaglandin E2.
        Blood. 2008; 111: 1327-1333
        • Najar M.
        • Fayyad-Kazan M.
        • Meuleman N.
        • Bron D.
        • Fayyad-Kazan H.
        • Lagneaux L.
        Mesenchymal stromal cells of the bone marrow and natural killer cells: cell interactions and cross modulation.
        J Cell Commun Signal. 2018; 12: 673-688
        • Ren G.
        • Su J.
        • Zhang L.
        • Zhao X.
        • Ling W.
        • L'huillie A.
        • Zhang J.
        • Lu Y.
        • Roberts A.I.
        • Ji W.
        • Zhang H.
        • Rabson A.B.
        • Shi Y.
        Species variation in the mechanisms of mesenchymal stem cell-mediated immunosuppression.
        Stem Cells. 2009; 27: 1954-1962
        • Liu S.
        • Liu F.
        • Zhou Y.
        • Jin B.
        • Sun Q.
        • Guo S.
        Immunosuppressive Property of MSCs Mediated by Cell Surface Receptors.
        Front Immunol. 2020; 11: 1076
        • Ren G.
        • Zhang L.
        • Zhao X.
        • Xu G.
        • Zhang Y.
        • Roberts A.I.
        • Chunhua Zhao R.
        • Shi Y.
        Mesenchymal Stem Cell-Mediated Immunosuppression Occurs via Concerted Action of Chemokines and Nitric Oxide.
        Cell Stem Cell. 2008; 2: 141-150
        • Ren G.
        • Zhao X.
        • Zhang L.
        • Zhang J.
        • L'Huillier A.
        • Ling W.
        • Roberts A.I.
        • Le A.D.
        • Shi S.
        • Shao C.
        • Shi Y.
        Inflammatory cytokine-induced intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 in mesenchymal stem cells are critical for immunosuppression.
        J Immunol. 2010; 184: 2321-2328
        • Andrews S.
        • Maughon T.
        • Marklein R.
        • Stice S.
        Priming of MSCs with inflammation-relevant signals affects extracellular vesicle biogenesis, surface markers, and modulation of T cell subsets.
        Journal of Immunology and Regenerative Medicine. 2021; 13100036
        • Kurte Mónica
        • Vega-Letter Ana María
        • Luz-Crawford Patricia
        • Djouad Farida
        • Noël Danièle
        • Khoury Maroun
        • et al.
        Time-dependent LPS exposure commands MSC immunoplasticity through TLR4 activation leading to opposite therapeutic outcome in EAE.
        Stem Cell Res Ther. 2020; 11: 416